ID: 982712164

View in Genome Browser
Species Human (GRCh38)
Location 4:158768836-158768858
Sequence GTGGGAGGTGCGGCCAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712164_982712172 -4 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712172 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
982712164_982712170 -5 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712164_982712185 19 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712164_982712168 -6 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712164_982712183 15 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712183 4:158768874-158768896 GGGGTTACGTGAGCCCGGGGCGG No data
982712164_982712187 27 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712164_982712179 10 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712164_982712186 26 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712164_982712184 16 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712164_982712181 12 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712164_982712180 11 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712180 4:158768870-158768892 CGCCGGGGTTACGTGAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712164 Original CRISPR GTGGGAGGTGCGGCCAGGAG CGG (reversed) Intergenic
No off target data available for this crispr