ID: 982712168

View in Genome Browser
Species Human (GRCh38)
Location 4:158768853-158768875
Sequence TCCCACCTCCCGCCTCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712161_982712168 -1 Left 982712161 4:158768831-158768853 CCCGCCCGCTCCTGGCCGCACCT No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712155_982712168 24 Left 982712155 4:158768806-158768828 CCCGCGTGCCCGGAGTACTGGGC No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712162_982712168 -2 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712160_982712168 2 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712158_982712168 15 Left 982712158 4:158768815-158768837 CCGGAGTACTGGGCCGCCCGCCC No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712156_982712168 23 Left 982712156 4:158768807-158768829 CCGCGTGCCCGGAGTACTGGGCC No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712153_982712168 25 Left 982712153 4:158768805-158768827 CCCCGCGTGCCCGGAGTACTGGG No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712163_982712168 -5 Left 982712163 4:158768835-158768857 CCCGCTCCTGGCCGCACCTCCCA No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712151_982712168 26 Left 982712151 4:158768804-158768826 CCCCCGCGTGCCCGGAGTACTGG No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712164_982712168 -6 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data
982712157_982712168 16 Left 982712157 4:158768814-158768836 CCCGGAGTACTGGGCCGCCCGCC No data
Right 982712168 4:158768853-158768875 TCCCACCTCCCGCCTCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712168 Original CRISPR TCCCACCTCCCGCCTCCCGC CGG Intergenic
No off target data available for this crispr