ID: 982712169

View in Genome Browser
Species Human (GRCh38)
Location 4:158768854-158768876
Sequence CCCGGCGGGAGGCGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712169_982712192 26 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712169_982712184 -2 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712169_982712180 -7 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712180 4:158768870-158768892 CGCCGGGGTTACGTGAGCCCGGG No data
982712169_982712195 28 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712169_982712181 -6 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712169_982712187 9 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712169_982712190 16 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712169_982712179 -8 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
982712169_982712183 -3 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712183 4:158768874-158768896 GGGGTTACGTGAGCCCGGGGCGG No data
982712169_982712186 8 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712169_982712194 27 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712169_982712185 1 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712169 Original CRISPR CCCGGCGGGAGGCGGGAGGT GGG (reversed) Intergenic