ID: 982712170

View in Genome Browser
Species Human (GRCh38)
Location 4:158768854-158768876
Sequence CCCACCTCCCGCCTCCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1065
Summary {0: 1, 1: 1, 2: 10, 3: 137, 4: 916}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712165_982712170 -10 Left 982712165 4:158768841-158768863 CCTGGCCGCACCTCCCACCTCCC No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712155_982712170 25 Left 982712155 4:158768806-158768828 CCCGCGTGCCCGGAGTACTGGGC No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712160_982712170 3 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712163_982712170 -4 Left 982712163 4:158768835-158768857 CCCGCTCCTGGCCGCACCTCCCA No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712153_982712170 26 Left 982712153 4:158768805-158768827 CCCCGCGTGCCCGGAGTACTGGG No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712161_982712170 0 Left 982712161 4:158768831-158768853 CCCGCCCGCTCCTGGCCGCACCT No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712162_982712170 -1 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712156_982712170 24 Left 982712156 4:158768807-158768829 CCGCGTGCCCGGAGTACTGGGCC No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712157_982712170 17 Left 982712157 4:158768814-158768836 CCCGGAGTACTGGGCCGCCCGCC No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712151_982712170 27 Left 982712151 4:158768804-158768826 CCCCCGCGTGCCCGGAGTACTGG No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712164_982712170 -5 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916
982712158_982712170 16 Left 982712158 4:158768815-158768837 CCGGAGTACTGGGCCGCCCGCCC No data
Right 982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG 0: 1
1: 1
2: 10
3: 137
4: 916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712170 Original CRISPR CCCACCTCCCGCCTCCCGCC GGG Intergenic
900019994 1:181571-181593 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
900113943 1:1020696-1020718 CCCAGCCCCCGCTCCCCGCCCGG - Intronic
900140246 1:1136822-1136844 CCCTCCTGCTGCCTCCCCCCAGG - Intergenic
900289245 1:1916904-1916926 CCCACCACCCGCCCCCAACCCGG - Intronic
900336448 1:2166454-2166476 CCCGCCTCCCGCCTCCCATCTGG + Intronic
900399074 1:2465587-2465609 CCCGCCACCTGCCACCCGCCGGG + Intronic
900422813 1:2562937-2562959 CCCACCTCCCCTCTCCCCGCTGG + Intronic
900469611 1:2847276-2847298 CCCTGCTCCCGCCTCCCCCAAGG + Intergenic
900490845 1:2948392-2948414 CCCACCTCCCGCCTCCTGGGTGG - Intergenic
900610736 1:3543568-3543590 GCCTCGCCCCGCCTCCCGCCCGG - Intronic
900900004 1:5509809-5509831 CCCTCCTCCCTCCTCCATCCAGG - Intergenic
901016756 1:6236159-6236181 ACCACTTCCCGGCCCCCGCCCGG - Intergenic
901036428 1:6338806-6338828 CTCACCTCCCGTCCCCAGCCTGG + Intronic
901059692 1:6466220-6466242 CCCGCCTCCCCCCGCCCGCCAGG - Exonic
901066596 1:6497339-6497361 CCCGCCGCCCGCCCCCCGCGCGG - Intronic
901462445 1:9399793-9399815 CTCCCCTCTCGCCTCCCACCAGG + Intergenic
901642720 1:10701216-10701238 CCCTCCTCCTGCCTCCTGCCCGG + Intronic
901845619 1:11980403-11980425 CCCTCCTCCCGCCTCCCCCTGGG + Exonic
902018738 1:13328619-13328641 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
902049905 1:13554998-13555020 CCCGCCTCCCGCCCCGTGCCCGG + Intergenic
902180116 1:14681760-14681782 TCCGCCTCCCGCCTCCCGGGAGG + Intronic
902214182 1:14924238-14924260 GCCCGCCCCCGCCTCCCGCCCGG - Intronic
902237450 1:15066664-15066686 CCCACCTCCCGCCCACCCCATGG - Intronic
902943461 1:19816604-19816626 CCCACCTCCCCACTCCCCCTGGG + Intergenic
903081482 1:20815859-20815881 CCCCCCTCCCCCCTCCCGGACGG - Intronic
903081682 1:20816311-20816333 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
903234754 1:21942613-21942635 CCCACCCCTCCCCTCCAGCCAGG + Intergenic
903383917 1:22914720-22914742 CCCTCCTCCCACCTGCCACCAGG + Intronic
903577265 1:24346680-24346702 CCCAGCTCCCACCTCCCTCATGG + Intronic
903637720 1:24833440-24833462 CCCCCCTCCCCCCTCCCGGACGG + Intronic
903637899 1:24833835-24833857 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
903962290 1:27064616-27064638 ACCCCCCCCCGCCTCCCTCCCGG - Intergenic
903993242 1:27288984-27289006 CCCCCCCCCCACCTCCCTCCCGG + Intronic
904028416 1:27519362-27519384 CCCACCGCCCGCCTGCCGCTGGG - Intergenic
904042089 1:27591016-27591038 CCCACCTCCCAGCCCCAGCCTGG + Intronic
904074356 1:27829136-27829158 CCCCCCCCCCACCTCCCTCCTGG - Intergenic
904784431 1:32974270-32974292 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
904784663 1:32974800-32974822 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
904857288 1:33509281-33509303 CCCCCCCCCCACCTCCCTCCGGG + Intergenic
905038055 1:34929987-34930009 CCGACCGCCCGCCCGCCGCCGGG - Intergenic
905240911 1:36580881-36580903 CCCTCCTCCCACCACCCTCCTGG - Intergenic
905317344 1:37091743-37091765 CCCGCCCCCCGCCTGCCACCCGG + Intergenic
905442821 1:38005644-38005666 CCCGGCCCCCTCCTCCCGCCCGG + Intergenic
905815856 1:40950251-40950273 CCCACCTCCCACCCTCCGACAGG - Intergenic
905974296 1:42164019-42164041 CCCAGCTCCAGCCTGCAGCCTGG + Intronic
906344079 1:45004416-45004438 CACACCTCCCGCCTCACACTGGG + Intronic
906427342 1:45725097-45725119 CCCCCCTCCCCCCTCCCGGACGG - Intronic
906535841 1:46550520-46550542 CCCACCCCCCGCCCCCGCCCAGG - Intronic
906761509 1:48382633-48382655 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
906761613 1:48382863-48382885 CCCCCCTCCCCCCTCCCGGACGG + Intronic
907240656 1:53079208-53079230 CCCACCTCCTGCCTCCCCTAAGG - Intronic
907414538 1:54305080-54305102 CCCACGCCACGCCTCCCGCCAGG - Intronic
907453497 1:54561915-54561937 CCCCCCCCCCACCTCCCTCCCGG + Intronic
907453773 1:54562546-54562568 CCCACCCCCCACCTCCCTCCCGG + Intronic
907920021 1:58903696-58903718 GCCACGTCCCGCCCGCCGCCCGG + Intergenic
908582043 1:65525983-65526005 CCCCACCCCCGCCGCCCGCCGGG - Intronic
909640896 1:77869739-77869761 CCCCCCCCCCGCCTGCCTCCCGG + Intronic
909641104 1:77870223-77870245 CCCCCCCCCCACCTCCCTCCCGG + Intronic
911498847 1:98661762-98661784 CCCTCCTCGGGCCTCCCGGCCGG + Exonic
912429345 1:109620892-109620914 CCCCCTCCCCGCCCCCCGCCAGG + Exonic
913994214 1:143638868-143638890 CCCCCCCGCCGCCTCCCTCCCGG - Intergenic
914780647 1:150781841-150781863 CTGACCTCCCACCTCCCTCCCGG - Intergenic
914801992 1:150968681-150968703 CCCTCTACCCGCCGCCCGCCTGG - Intronic
914875729 1:151511629-151511651 CCCTCCTCCCGTCTCCCACTCGG - Intronic
914888256 1:151600965-151600987 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
915208424 1:154287776-154287798 CTGACCCCCCACCTCCCGCCCGG - Intergenic
915453142 1:156020735-156020757 CCCGCCTCCCGCCTCTTGCAAGG + Intronic
915471647 1:156129285-156129307 CCCACCTCCCCCCACCAGGCAGG - Intronic
915472679 1:156135320-156135342 CCCACCTCACCCCTCTCTCCAGG + Intronic
915539467 1:156557698-156557720 CCCCCCCCGCGCCTCCCTCCCGG - Intronic
915539690 1:156558190-156558212 CCCCCCCCGCGCCTCCCTCCCGG - Intronic
915579894 1:156807262-156807284 CCCACCAGCCCCCACCCGCCTGG - Exonic
916415565 1:164589134-164589156 CCCACTGCCCCTCTCCCGCCTGG - Intronic
917376055 1:174350190-174350212 CCCCCCCCCCACCTCCCTCCCGG + Intronic
917537992 1:175888264-175888286 CCCAGCTCCCTCCTCCCCCAGGG + Intergenic
918018317 1:180659592-180659614 CCCACCCCCCACCCCCCGCCGGG + Intronic
918332496 1:183472871-183472893 CCAACCTCCCTCCTCGCACCGGG - Intronic
918780214 1:188690458-188690480 CCCCCCTCCCCCCACCCCCCCGG + Intergenic
919598720 1:199596442-199596464 CCCTCCTCCCACCCCCCACCAGG + Intergenic
919669985 1:200329685-200329707 GCCCCCTCCGGCCTCCTGCCTGG + Intergenic
919861236 1:201740482-201740504 CCCTCCTCCTTCCACCCGCCTGG - Intronic
919914979 1:202133671-202133693 CCCAGCTCCCGCCCCTCCCCAGG - Exonic
919927396 1:202199372-202199394 CCCACCTCCGGCGACCCCCCGGG - Intronic
920145963 1:203861419-203861441 ACCTCCTCCCGCCTCCCTCCAGG + Intergenic
920177744 1:204113704-204113726 CCCACCTCCTTCCTCCAGGCTGG - Intronic
920223995 1:204424803-204424825 CCCAGCTCCTGCCACCAGCCTGG + Exonic
920429233 1:205905452-205905474 CCCACCCCCCACCCCCCGACAGG - Intergenic
920702928 1:208231338-208231360 CCTCCCTCCCGCTTCCCTCCTGG - Intronic
921030621 1:211332459-211332481 CCCACCTCCCTCCATCCTCCAGG - Intronic
921140271 1:212299050-212299072 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
922733860 1:227969169-227969191 CCCACCTTTGGCCTCCCGGCAGG + Intergenic
922973228 1:229760673-229760695 CCCACCTCCAGCCTCTGCCCAGG - Intergenic
923545754 1:234922140-234922162 CCCACCTGCCACCTCCCCTCAGG - Intergenic
924944632 1:248838178-248838200 CTCCACTCCCGCCTCCCGCGCGG - Intergenic
1062860315 10:805232-805254 CCAACCTCCGGCCAGCCGCCTGG + Intergenic
1063352820 10:5372350-5372372 GCCACCTGCACCCTCCCGCCGGG - Intronic
1064108333 10:12519396-12519418 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1064108532 10:12519848-12519870 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1064622657 10:17230345-17230367 CCCTCCTTCCTTCTCCCGCCCGG - Intronic
1064663575 10:17629258-17629280 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1064712351 10:18140499-18140521 CCCGCGTCCCGCCTCCCGAGCGG + Intergenic
1065012263 10:21430558-21430580 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1065239643 10:23693590-23693612 CCCGCCCGCCGCCTCCCGGCTGG - Intergenic
1065336220 10:24656926-24656948 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1065336377 10:24657283-24657305 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1065687782 10:28303030-28303052 CCCGGCCCCCGCCTCCAGCCCGG + Intronic
1066085393 10:31970038-31970060 CCCCCCCCCGGCCTCCCTCCCGG - Intergenic
1066085586 10:31970446-31970468 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1066518672 10:36192367-36192389 TCCACCTCCAGGCTCCTGCCTGG + Intergenic
1067031116 10:42879287-42879309 CCCACACCCTGCCTCCCACCAGG - Intergenic
1067060104 10:43073914-43073936 CATCCCGCCCGCCTCCCGCCAGG + Intergenic
1067293283 10:44959697-44959719 CCCGCTCCCCGCCTCTCGCCCGG - Intronic
1068969828 10:62948288-62948310 CACCCCCCCCGCCTCCCTCCCGG - Intergenic
1069294460 10:66826904-66826926 CCCACTCCCAGCCTCCAGCCTGG + Intronic
1069825864 10:71254631-71254653 CCCGCCTCCCACCTTCCTCCTGG + Intronic
1069888669 10:71639374-71639396 CCCACCTCCCTGCTCCTGCTAGG - Intronic
1070280275 10:75043621-75043643 CGCACATCCCGCTTCCGGCCTGG + Intronic
1070304902 10:75234316-75234338 CCAAGACCCCGCCTCCCGCCCGG - Intronic
1070658220 10:78285754-78285776 CCCACCACCCCACTCCCACCAGG - Intergenic
1070931720 10:80265828-80265850 CCCACCTCCCAACCCCCACCAGG - Intergenic
1071544779 10:86521313-86521335 CCACCCTCCCGGCTCCCTCCCGG + Intronic
1072149600 10:92674543-92674565 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1072180601 10:92976033-92976055 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1072189146 10:93066369-93066391 CCCTCCGCCCTCCTCCCACCTGG - Intronic
1072549905 10:96469530-96469552 CCCACCACCAGCCTCCCGCCTGG + Intronic
1072602155 10:96941063-96941085 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1072719528 10:97772013-97772035 CCCACCTCGGGGCTCCAGCCCGG + Intergenic
1072891472 10:99329199-99329221 GCCACCTCCAGCCTCCAGCGGGG + Exonic
1072949731 10:99839091-99839113 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1072976733 10:100065370-100065392 CCAACCTCTCGCCTCCTCCCAGG - Exonic
1072999833 10:100277591-100277613 ACCCCCTCCCACCTCCCTCCCGG - Intronic
1073053463 10:100684228-100684250 CTCCCCTCCCCCCTCCCCCCCGG - Intergenic
1073098912 10:100997082-100997104 CCCAGCTCCCGGCGCCCGCCTGG - Intronic
1073463351 10:103679214-103679236 CCCACCTCCCCCATCTGGCCAGG + Intronic
1074116026 10:110458043-110458065 CCCACCTGCTGCCACCAGCCAGG - Intergenic
1074618477 10:115093461-115093483 CCCGCTCCCCGCCTCCGGCCGGG + Intronic
1075166647 10:120073965-120073987 CCCACCTGCAGCCTTCCTCCAGG + Intergenic
1075629335 10:123991739-123991761 TCCACCTCGCTCATCCCGCCGGG - Intergenic
1075715809 10:124554651-124554673 CCCACCTGGCCCCTCCCACCTGG - Intronic
1076381429 10:130026963-130026985 CCCACCGCCCACCTGCTGCCAGG + Intergenic
1076512003 10:131020398-131020420 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512013 10:131020422-131020444 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512023 10:131020446-131020468 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512033 10:131020470-131020492 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512043 10:131020494-131020516 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512053 10:131020518-131020540 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512063 10:131020542-131020564 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512073 10:131020566-131020588 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512083 10:131020590-131020612 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512093 10:131020614-131020636 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512170 10:131020835-131020857 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076512180 10:131020859-131020881 CCCACACCCCGCATCCCTCCAGG + Intergenic
1076550988 10:131278073-131278095 CCCGGCTCCTGCCTCCCCCCGGG + Intronic
1076865346 10:133163883-133163905 CCCAAATCCCTCCTCCCACCTGG + Intronic
1076865365 10:133163937-133163959 CCCAAATCCCTCCTCCCACCTGG + Intronic
1076865401 10:133164045-133164067 CCCAAATCCCTCCTCCCACCTGG + Intronic
1076888366 10:133272739-133272761 CACCCCCCCCACCTCCCGCCAGG + Intronic
1077081514 11:726514-726536 CGCACCTCCCACCCCTCGCCCGG - Intronic
1077149522 11:1064078-1064100 CTCACCTCCCACCCCCCACCAGG + Intergenic
1077221984 11:1421944-1421966 CCCACCTGCCCCCTCTCTCCCGG - Intronic
1077340625 11:2024802-2024824 CCCACCTGCAGTCTCCCGCAGGG - Intergenic
1077411428 11:2405661-2405683 CCCATCTCCCCTCTCCTGCCAGG + Intronic
1077490370 11:2858270-2858292 CCCACCCCCCGGCCACCGCCTGG + Intergenic
1077608557 11:3628701-3628723 CCCACATCCCACCCCCTGCCAGG + Intergenic
1078057565 11:8019723-8019745 CCCTCCTCGCCCCGCCCGCCAGG - Intronic
1078059647 11:8034797-8034819 CCCACCTCCTGCCCTCCGTCAGG - Intronic
1078091726 11:8268377-8268399 CCCACGTCCCGCGTGCCCCCGGG + Intronic
1078105761 11:8357079-8357101 CCCTCTTCCCTCCTCCCGGCAGG + Intergenic
1078176911 11:8978229-8978251 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1078190985 11:9092050-9092072 CCCACCTCCCACCTCCCACGTGG - Intronic
1078891367 11:15561195-15561217 CCCCCTCCCCGCCCCCCGCCGGG + Intergenic
1079056048 11:17207662-17207684 CCCGACTCCCCCCTCCCTCCGGG - Intronic
1079099372 11:17531361-17531383 TCCACCCCCTGCCTCCAGCCTGG + Intronic
1079407718 11:20160289-20160311 GCCTCCTCGCGCCCCCCGCCGGG - Exonic
1079444967 11:20548858-20548880 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1080374186 11:31688303-31688325 CCCACCTCCATCCTCACCCCTGG + Intronic
1080388845 11:31826138-31826160 CCCACATCCCGCTACCCCCCGGG + Intronic
1080591693 11:33729510-33729532 CCCACCCCCCAACTCCCGACAGG - Intronic
1080647067 11:34195070-34195092 CCCCACTCCCCCCCCCCGCCGGG - Intronic
1081289164 11:41305033-41305055 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1081741581 11:45444777-45444799 CCCACCTCCCCCATCCCGCTTGG + Intergenic
1081831856 11:46121310-46121332 CCCCCCTCCCGATTCCGGCCCGG - Intergenic
1081873165 11:46392231-46392253 CCCACCCGCAGCCTCCCGCTGGG - Intergenic
1082238561 11:49850452-49850474 CCTAGCTCCCGCCCCCAGCCCGG - Intergenic
1082658074 11:55874685-55874707 CCTAGCTCCCGCCACCAGCCCGG + Intergenic
1083259741 11:61516503-61516525 CCCACCACCCGCCTGCCCCGCGG - Intronic
1083306606 11:61765013-61765035 CCCCACTCCCGCCTGCGGCCAGG + Intronic
1083579112 11:63813599-63813621 ACCGCCTCCCGCCTCCTGGCCGG - Exonic
1083668312 11:64286898-64286920 GCCACCTCCCGCCCCCCACCCGG - Intronic
1083726855 11:64633021-64633043 CCCACCTCCCACCTCATGGCTGG + Intronic
1083764828 11:64836704-64836726 CCCACCCCCCCCCCCCCCCCAGG - Intronic
1083779073 11:64908940-64908962 ACCCCCTCCCGCCCACCGCCCGG - Intronic
1083922332 11:65787558-65787580 CCCACACCGCGCCTGCCGCCTGG - Intronic
1083932367 11:65853003-65853025 CCCACCTCCCTCCCTCCCCCAGG + Intronic
1084175638 11:67420911-67420933 CTGAGCTCGCGCCTCCCGCCCGG + Intronic
1084507286 11:69576140-69576162 CCCACCCCCCGCAACCAGCCTGG - Intergenic
1084568460 11:69944820-69944842 CCCGCCTCCCTCCTTCCTCCAGG + Intergenic
1084597995 11:70128618-70128640 CGCACCTCCCGCTTCGCTCCAGG - Intronic
1084737331 11:71114005-71114027 CCCTCCTCCAGCCCCCCGCTTGG + Intronic
1084957024 11:72696978-72697000 CCCACCTGAGGCCTCCAGCCAGG + Exonic
1085296898 11:75436463-75436485 ACGTCCTCCCGCCCCCCGCCCGG + Intronic
1085516246 11:77113433-77113455 CCCTCCTCCCTCCTCCCTCCTGG - Intronic
1085527697 11:77173753-77173775 CCCTCCTGCTGCCTCCTGCCTGG + Intronic
1086300285 11:85420526-85420548 CCCACATCCCCCCTTCCCCCAGG + Intronic
1086455612 11:86956068-86956090 CCCACCTCCAGCCGCCAGCGGGG + Intergenic
1086698010 11:89865698-89865720 CCTAGCTCCCGCCCCCAGCCCGG + Intergenic
1086708152 11:89978790-89978812 CCTAGCTCCCGCCCCCAGCCCGG - Intergenic
1087102622 11:94380195-94380217 CCCACCTCCCAACTCCAGTCTGG - Exonic
1087594844 11:100240228-100240250 CACACCCCCCGACCCCCGCCAGG + Intronic
1088201341 11:107338564-107338586 CCCACCTCCCACCCACCGACAGG + Intronic
1088577985 11:111290095-111290117 CCCTCCACCCTCCTCCAGCCTGG - Intergenic
1088754730 11:112876416-112876438 TCCAGCTCCCGCCTCTTGCCTGG + Intergenic
1089563371 11:119357084-119357106 CCCCCCTCCCACCCCCCGCACGG - Intronic
1090334365 11:125953036-125953058 CCCACCTCCCGGCTGGCTCCAGG - Intergenic
1090653066 11:128823970-128823992 GCCGCCTCCCACCCCCCGCCAGG + Intergenic
1090788404 11:130069700-130069722 CCAACCGCGCGCCCCCCGCCCGG - Intergenic
1090906877 11:131084328-131084350 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1091061248 11:132464403-132464425 CCTACCCACCGCCTCCAGCCTGG + Intronic
1091238492 11:134037140-134037162 CCCTCCTCCCGCTCCCCTCCCGG - Intergenic
1202823610 11_KI270721v1_random:79991-80013 CCCACCTGCAGTCTCCCGCAGGG - Intergenic
1091373374 12:11185-11207 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
1091594353 12:1865705-1865727 CTCCCCTCGCGCCTGCCGCCCGG - Intronic
1092295979 12:7199975-7199997 CTGACCCCCCGCCTCCCTCCCGG + Intronic
1092453592 12:8625252-8625274 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1094414399 12:30201872-30201894 CCCAGCGCGCGCCTCCCGCCTGG - Intergenic
1094514004 12:31117649-31117671 CCCACCTCCCCCCTGGCTCCTGG + Intergenic
1095439819 12:42228462-42228484 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1095439900 12:42228644-42228666 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1095619770 12:44237671-44237693 CCCACCACCGCACTCCCGCCTGG + Intronic
1096021931 12:48332337-48332359 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1096255017 12:50057603-50057625 CCCTCCCGCCGCCTCCCGGCCGG + Exonic
1096519283 12:52174994-52175016 CCCAACACCCACCTCCTGCCTGG - Intronic
1096523046 12:52194794-52194816 CCCACCTCCCAACCCCTGCCAGG - Intergenic
1096660818 12:53122999-53123021 CCCACCTCCAGCCCCCCGCCCGG - Intronic
1096743856 12:53713058-53713080 ACCTCCTCCCACCTCCCTCCTGG + Intronic
1096977643 12:55708418-55708440 CCCATCCCCCGCCCCCAGCCCGG + Intronic
1097192758 12:57227191-57227213 CCCCCCTCCCTCCTCCAGCCAGG - Intergenic
1098370952 12:69759792-69759814 CTGACCTCCCACCTCCCTCCCGG + Intronic
1098412687 12:70202112-70202134 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1098412906 12:70202597-70202619 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1098413011 12:70202827-70202849 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1098883967 12:75942346-75942368 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1098991016 12:77065302-77065324 CCCAATTCCCGCCTCCCCACTGG + Intronic
1099914689 12:88877526-88877548 CCCTCCTCCTGCCTCCTGACAGG - Intergenic
1100008191 12:89919783-89919805 CCCGCCTCCCGCCCAGCGCCCGG - Intergenic
1100032807 12:90213973-90213995 CCCACCTCCTACCTCACCCCAGG + Intergenic
1100372197 12:93978569-93978591 CCCACCTCCCCACTTCCTCCTGG - Intergenic
1100570676 12:95841390-95841412 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1100582508 12:95948526-95948548 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1100764841 12:97852316-97852338 CCCACCCCCCACATCCCGACTGG - Intergenic
1101915463 12:108892539-108892561 CCCACCTCCCTCCTCATGCCCGG + Intronic
1102200644 12:111055615-111055637 CCCAGCTCCTGCCTCCCGCCTGG + Intronic
1102294128 12:111723686-111723708 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1103449265 12:121016625-121016647 CCCACCTCCCCATTCCCACCTGG - Intergenic
1103591386 12:121994009-121994031 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1103604861 12:122078970-122078992 CCCGCCGCCCGCCTCCGGCGCGG + Exonic
1103659915 12:122506019-122506041 CCCCCCTGCCGCCTGCCCCCCGG + Intronic
1103720897 12:122974899-122974921 CCCACCCCCCGCCGTCTGCCCGG - Exonic
1103856407 12:123973392-123973414 CCCGGCCCCCGCCTCCCTCCGGG - Exonic
1104660515 12:130608576-130608598 CCCACTGCCCACCTCCCCCCAGG - Intronic
1104823653 12:131693424-131693446 CCTCCCTCCTGCCTCCTGCCGGG + Intergenic
1104843287 12:131834633-131834655 CCCACCCCTCCTCTCCCGCCAGG - Intronic
1104882193 12:132080197-132080219 CCAACCTTCTGCTTCCCGCCAGG - Exonic
1104948596 12:132428572-132428594 CCCAGCTCCAGCCACCCACCCGG + Intergenic
1104958447 12:132477053-132477075 CGCACCTTCCTCCTCCCTCCAGG + Intergenic
1105249561 13:18685727-18685749 CCCACCTCCCCCATCCCTACAGG + Intergenic
1105472249 13:20704309-20704331 CCCACCTGCCGGGCCCCGCCAGG - Intronic
1105520227 13:21124745-21124767 CCCCCCCCCCGCCCCCCGACAGG + Intergenic
1106602679 13:31200608-31200630 CTCCCGTCCAGCCTCCCGCCCGG - Intronic
1106709630 13:32315874-32315896 TCCATTTCCCGCCTCCGGCCCGG + Intronic
1106735890 13:32587055-32587077 CGCGCCGCCCGCCTGCCGCCCGG - Intronic
1108404084 13:50082149-50082171 CCCTCCCCCCTCCTCCCGCCAGG + Exonic
1108608616 13:52063984-52064006 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1110810532 13:79807383-79807405 CCCACCTCCCTACTGCAGCCAGG - Intergenic
1112173107 13:96994205-96994227 GGCACCTCCCGTCTCCCTCCGGG + Intronic
1113894568 13:113755377-113755399 CCCACCTGCCTCCTCTCCCCAGG - Intergenic
1113959618 13:114119483-114119505 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1113959629 13:114119518-114119540 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1113959700 13:114119763-114119785 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1113959742 13:114119900-114119922 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1113959808 13:114120109-114120131 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1113959821 13:114120144-114120166 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1113959887 13:114120359-114120381 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1113959900 13:114120394-114120416 CCCCCCTCCCCTCTCCAGCCAGG + Intronic
1114199234 14:20506423-20506445 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1114199457 14:20506923-20506945 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1114427796 14:22637519-22637541 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1114427948 14:22637847-22637869 CACCCCCCCCGCCTCCCTCCCGG - Intergenic
1114626808 14:24135843-24135865 TCCACCTCCCGCCTCCCAACTGG - Intergenic
1115618892 14:35121832-35121854 CCCACCTCCCCCCTACCTCTAGG + Intronic
1115647900 14:35383068-35383090 CCCACCTTCCGTCTCCCTCATGG - Intergenic
1115703398 14:35977070-35977092 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1115703470 14:35977238-35977260 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1115703525 14:35977369-35977391 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1118340998 14:64895306-64895328 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1118341171 14:64895695-64895717 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1118428527 14:65692509-65692531 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1118762639 14:68890105-68890127 CCAGCCTCCTGCCTCCCCCCAGG - Intronic
1121417496 14:93789063-93789085 AGCCTCTCCCGCCTCCCGCCCGG + Intergenic
1122113752 14:99517793-99517815 CCCACCCCCAGCTTCCTGCCTGG + Intronic
1122221318 14:100240308-100240330 ACGACCTCCCGCGTCCCGCCCGG - Intronic
1122228114 14:100291448-100291470 CCCACCTACCACCGCCAGCCAGG - Exonic
1122275197 14:100587419-100587441 CCCGCCCCCCGCCCCCAGCCCGG + Intergenic
1122389206 14:101368810-101368832 CCCACTGCCTGCCTCCCTCCTGG + Intergenic
1122568457 14:102677214-102677236 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1122568510 14:102677340-102677362 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1122620748 14:103056666-103056688 CCCACCCCCTCCCCCCCGCCGGG - Intronic
1122691533 14:103534055-103534077 CCTCCCTGCCGCCTCCCACCAGG - Intronic
1122747993 14:103911004-103911026 CCCACCCCCCACCTCACCCCCGG - Intergenic
1122931101 14:104933427-104933449 TCCACCTCCCACCCCGCGCCGGG + Exonic
1122963874 14:105112175-105112197 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1122983178 14:105200661-105200683 CCCACCTCCCGGCCCCACCCAGG + Intergenic
1123074523 14:105661379-105661401 CCCACCTCCCCCTTTCCACCTGG - Intergenic
1123534828 15:21174907-21174929 CCCCCCCCCCCCATCCCGCCCGG + Intergenic
1124009891 15:25829990-25830012 ACCACCTCCTGCCTCCACCCCGG - Intronic
1124251810 15:28111629-28111651 CTCCACTCCCTCCTCCCGCCTGG + Exonic
1124291656 15:28457290-28457312 ACCACCCACCCCCTCCCGCCGGG + Intergenic
1124575446 15:30903884-30903906 GCCACCTCGCACCTCCCACCTGG - Exonic
1124598306 15:31109858-31109880 CCCATCGCCCGTCTCCAGCCTGG - Intronic
1124654784 15:31499394-31499416 CCCATCTCCTGCCTCCCACCAGG + Intronic
1124937470 15:34186519-34186541 CCCACCTCCTGCCTGCTTCCTGG - Intronic
1125429478 15:39580981-39581003 CCCACCTCCCGCTTCCTGCCCGG + Intergenic
1125508277 15:40279869-40279891 CCCACCTGCCGCCTCCCCGCGGG + Intronic
1125536159 15:40441871-40441893 CCCCCCTGCCGCCCCCGGCCCGG - Intronic
1125716085 15:41820810-41820832 CCCACCCCCTACCTCCCACCAGG + Exonic
1125868500 15:43076760-43076782 ACCCCCTCCCACCTCCCTCCCGG - Intronic
1126295448 15:47132729-47132751 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1127154293 15:56110305-56110327 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1127584328 15:60366790-60366812 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1127584453 15:60367053-60367075 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1127584503 15:60367151-60367173 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1127584610 15:60367381-60367403 ACCCCCCCCCGCCTCCCTCCCGG - Intronic
1127584630 15:60367420-60367442 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1127606219 15:60591511-60591533 CTCCCCTCCCGCCCCCGGCCCGG + Intronic
1128151052 15:65363652-65363674 CCCGCCACCCGCCTCCTGCCAGG + Intronic
1128841180 15:70853215-70853237 CCCCCCCCCCGCCCCCCGCAAGG + Intronic
1128938528 15:71768997-71769019 CCCCCCGCCCACCTCCCTCCCGG - Intronic
1128938657 15:71769275-71769297 CCCCCCGCCCACCTCCCTCCCGG - Intronic
1129257231 15:74340533-74340555 CCCACCTCCCTCCTCCTGGCAGG + Intronic
1129297618 15:74608614-74608636 CCCACCTCCCACCTGCCCCTGGG + Intronic
1129322277 15:74782021-74782043 CCCACGCCCCGCCGCGCGCCGGG + Intergenic
1129333173 15:74838162-74838184 AGCAGCTCCCGCCTCCGGCCCGG + Exonic
1129423904 15:75451377-75451399 CCCGCCACCAGGCTCCCGCCCGG + Intronic
1129431361 15:75503757-75503779 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1129463784 15:75712713-75712735 CCCACTTCCAGCCCCCGGCCTGG - Exonic
1129705717 15:77793026-77793048 ACCACCTCCAGCCTCCTCCCTGG + Intronic
1129770034 15:78197230-78197252 CCCCACTCCCACCTCCAGCCCGG - Intronic
1130224404 15:82046258-82046280 GCCTCCTCCCGCCCCCGGCCTGG - Intergenic
1130512448 15:84600906-84600928 CCAGCCTCCCTCCTGCCGCCCGG + Intergenic
1130908694 15:88256833-88256855 TCCTCCCCCCGCCCCCCGCCCGG + Intergenic
1130946667 15:88553527-88553549 CCGACCCCCCACCTCCCTCCCGG + Intergenic
1130946692 15:88553579-88553601 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1131074661 15:89487366-89487388 CCCAGCTGCCACCTCCAGCCTGG - Intronic
1131125649 15:89854882-89854904 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1131177277 15:90217891-90217913 CCCACCTCCCGCCTCTGGCCTGG - Intronic
1132178264 15:99732878-99732900 GCCGCCTCCCGCCTCCGGGCAGG - Intronic
1132453671 16:10736-10758 CCCACCCCCCGCCCCCAGGCCGG - Intergenic
1132576266 16:665817-665839 CCCCCATCCCGCCCCCGGCCCGG - Intronic
1132652478 16:1027910-1027932 CCCACCTCCCTCCTCCCCCGAGG - Intergenic
1132712144 16:1273723-1273745 CCCAGCTCACTACTCCCGCCTGG + Intergenic
1132733862 16:1376122-1376144 CGCTCCTCCCTCCTCCCTCCAGG + Intronic
1132776865 16:1599506-1599528 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1132815087 16:1822041-1822063 CCCACCCCCCGGCTCTCTCCTGG - Intronic
1132853154 16:2033721-2033743 ACTTCCTGCCGCCTCCCGCCAGG - Intronic
1132933175 16:2468917-2468939 CCCACCTCCCACCTCTCCACTGG - Intergenic
1133106141 16:3510921-3510943 CCCAGCTCCCAGCTCCAGCCTGG - Intronic
1133744116 16:8674471-8674493 CCCGCCTGCCACCTCCCTCCTGG + Intergenic
1134108109 16:11498585-11498607 CCCACCCCCCTCCTCTCCCCAGG + Intronic
1134217405 16:12326832-12326854 CCCACCTCACACCTCCCGCAAGG - Intronic
1134256618 16:12617667-12617689 CCCACCTCCCACCTCCAGATGGG + Intergenic
1135721581 16:24822554-24822576 CCCACCTCCCTCCTCCCTCAGGG + Intronic
1136248164 16:28986723-28986745 CTCACCTCCCACCTCCCACCTGG - Intronic
1136512664 16:30748675-30748697 CCCACCCCCCCCCACCCCCCAGG + Intronic
1136572260 16:31104739-31104761 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1136611514 16:31369291-31369313 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1136707128 16:32200383-32200405 ACCACCCACCCCCTCCCGCCAGG - Intergenic
1136760782 16:32729034-32729056 ACCACCCACCCCCTCCCGCCAGG + Intergenic
1136807321 16:33141352-33141374 ACCACCCACCCCCTCCCGCCAGG - Intergenic
1136984378 16:35085101-35085123 CCCACCTGCCACCTGCGGCCAGG + Intergenic
1137569652 16:49557294-49557316 CCCCCCTCCCTCCTCCTGCCAGG - Intronic
1138305591 16:55971658-55971680 ACCACCCCCCGCCGCCCACCTGG - Intergenic
1138597832 16:58038591-58038613 CCCACCCCCCACCTCCCTGCAGG + Intronic
1139150927 16:64381229-64381251 CCCACCCCTGGCCTCCCTCCTGG - Intergenic
1139434101 16:66926269-66926291 CCCACCTCCCAGCACCCACCAGG + Intergenic
1139513957 16:67442577-67442599 CCCACCTCTTGCCTCCCACCAGG - Intronic
1139864642 16:70052146-70052168 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1140218638 16:73028016-73028038 CCCACCTCCCACCTCCTCCCAGG + Intronic
1140994328 16:80243864-80243886 CCCCCCACCCGTCTCCCTCCCGG - Intergenic
1141025226 16:80540800-80540822 CCCACTTCCCTCTTCCCTCCCGG + Intronic
1141495517 16:84406921-84406943 TCCTCCTCCAGCCTCCAGCCAGG + Intronic
1141584921 16:85027665-85027687 GCCGCCTCCCGCCCCCCGCGAGG + Intergenic
1141682573 16:85553222-85553244 CCCACCCCGCGCGCCCCGCCGGG - Intergenic
1141695021 16:85615027-85615049 CCGTGCTCCCGCCTCCCGGCAGG + Intronic
1141762701 16:86039069-86039091 CCCACCACCCCCTTCCCTCCAGG - Intergenic
1141869495 16:86775093-86775115 CCCACCACCCACCCGCCGCCTGG - Intergenic
1141871393 16:86788979-86789001 CTCGCCTCCCGCCTGCCCCCGGG - Intergenic
1141989422 16:87602066-87602088 CGCGCCTCGCCCCTCCCGCCGGG - Intronic
1141993122 16:87621564-87621586 CCCACCTACAGCCGCCAGCCAGG + Intronic
1142034201 16:87853764-87853786 CCCACTCCCCGCCTCCCTCCGGG - Intronic
1142049928 16:87951596-87951618 CCCTCCTCCTCCCGCCCGCCGGG + Intronic
1142120916 16:88386347-88386369 CTCTCTTCCCGCCTCCTGCCCGG + Intergenic
1142136244 16:88453216-88453238 CGCACCTCCCGCCCCGCCCCCGG - Intergenic
1142163315 16:88570578-88570600 CCGGCCTCCCGCCGCCCTCCCGG - Intronic
1142192258 16:88723377-88723399 CCCAACCCCAGCTTCCCGCCTGG - Intronic
1203062934 16_KI270728v1_random:989348-989370 ACCACCCACCCCCTCCCGCCAGG + Intergenic
1142533706 17:598984-599006 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1142715065 17:1742798-1742820 CCCACCCCTCCCCTCCCACCAGG - Intergenic
1142818691 17:2447688-2447710 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1142818865 17:2448064-2448086 CCACCCCCCCGCCTCCCTCCCGG - Intronic
1142867008 17:2797323-2797345 CCTACCTTCTGCCCCCCGCCGGG - Intronic
1142913108 17:3112516-3112538 CCCCCCCCCCACCTCCCTCCTGG + Intergenic
1142978396 17:3658307-3658329 CCCACCGCCCCGCTCCCGCTGGG - Intronic
1143036627 17:4003364-4003386 CTCTCCACCCGCCTCCCGCGTGG + Intergenic
1143101673 17:4507944-4507966 TCCTCCTCCCTCCTCCAGCCAGG - Intronic
1143125105 17:4636858-4636880 CCCACCTCCCCAATCCCTCCTGG + Intronic
1143374813 17:6461286-6461308 CCCATCTCCCTCCTCCCGGGTGG - Intronic
1143492935 17:7294487-7294509 TCCACCTCGCTCATCCCGCCGGG + Exonic
1143503917 17:7353492-7353514 ACCACCTCCCGCCGCTCTCCTGG - Exonic
1143591301 17:7886985-7887007 CCCACCTCCCCTCTCCCCCTGGG + Intronic
1144481956 17:15637103-15637125 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1144536520 17:16095652-16095674 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1144725939 17:17502853-17502875 CCCACCTCACGCCTCTGTCCAGG + Intergenic
1144956023 17:19019295-19019317 CCCAGCTCCAGCCTCCTCCCTGG - Intronic
1145214770 17:21043124-21043146 CCCCCCCCCCCCCTCCCGGCCGG + Intronic
1145895617 17:28456046-28456068 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1145940570 17:28741374-28741396 CCCACTTCCCACTTCCCTCCTGG + Intronic
1145969575 17:28949298-28949320 CCCTCTTCCCTCCTCCCTCCCGG - Intronic
1145970005 17:28951007-28951029 CTCACCTCCCCCCTCCCCCCGGG - Exonic
1146052867 17:29566983-29567005 CCCGCCGCCCGCTGCCCGCCGGG - Exonic
1146066684 17:29641368-29641390 CCCACCTCCCACCCCCTTCCAGG + Intronic
1146215976 17:30979535-30979557 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1146216083 17:30979765-30979787 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1146290527 17:31603385-31603407 CCCACCTCCCTCCCACAGCCAGG - Intergenic
1146444135 17:32922206-32922228 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1146444436 17:32922875-32922897 CCACCCCCCCGCCTCCCTCCCGG + Intergenic
1146790421 17:35747729-35747751 CCCACCTACCGCTCCCCTCCTGG + Intronic
1146916246 17:36680195-36680217 CCCACCACCCGCTTCCCTCTGGG - Intergenic
1147044634 17:37743763-37743785 CCCACCCCCGGCCTCTCCCCGGG - Intronic
1147258927 17:39197506-39197528 CTCCCCTCCCGCCGCCGGCCCGG + Exonic
1147318470 17:39632267-39632289 CCCACCTCCCTCATGCCTCCTGG - Intronic
1147319233 17:39636101-39636123 CTCACATCCCACCTCCCGCTGGG - Exonic
1147341201 17:39754188-39754210 CACACCTTCCTCCACCCGCCTGG - Intergenic
1147575391 17:41595999-41596021 CCCACCTCCCTCCCCCAGACGGG + Intergenic
1147705271 17:42421721-42421743 CCCACCCCCCGGCTCCGCCCGGG - Intronic
1147963330 17:44180538-44180560 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1148128178 17:45247515-45247537 GCCCCCTCCGGCCTCCCGCAGGG - Intergenic
1148332791 17:46822009-46822031 TCCGGCTCCCGACTCCCGCCTGG - Intronic
1148645452 17:49217586-49217608 CCCGCCCCCCGCCCCCCACCAGG - Intronic
1148645964 17:49219836-49219858 CCCACTCCCTGCCCCCCGCCAGG + Exonic
1148772754 17:50076562-50076584 CACACCTCCGGCCACCCCCCAGG + Exonic
1148837110 17:50471163-50471185 CCCACCTCCCGTCACCCAGCTGG + Intronic
1148873504 17:50672949-50672971 CCCACCCCCCGCCTCCCTCCAGG + Exonic
1149512754 17:57256617-57256639 CCCTCCTCCTCCCCCCCGCCCGG - Exonic
1149568471 17:57655492-57655514 CCCACCTCTCCCCACCCACCCGG + Intronic
1151293457 17:73166292-73166314 CCCACCCCCCGCCTCCCTCAGGG - Intronic
1151314015 17:73311142-73311164 CCCTCCCCCCGCACCCCGCCAGG + Intronic
1151347493 17:73511049-73511071 CCCACTGCCCGCCGCCCGGCTGG + Intronic
1151491034 17:74432447-74432469 ACCCCCGCCCGCCCCCCGCCTGG + Intronic
1151649235 17:75456098-75456120 CCCCCCTCCCGCTTCCAGCTCGG - Intronic
1151708421 17:75785084-75785106 CCCCCCTTCCTCCTCCGGCCCGG + Intronic
1151879322 17:76885618-76885640 GCCACCTCCCAGCTCCCTCCTGG + Intronic
1152020280 17:77776827-77776849 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1152209890 17:78997419-78997441 CCCACCGCCCGGCCCCCGGCAGG - Exonic
1152350146 17:79779504-79779526 CCCAGCTCCAGCCTCCCGGCAGG - Intronic
1152782631 17:82232906-82232928 CCCCCCCCCCGCCGCCCCCCAGG - Intronic
1152809878 17:82376367-82376389 CCCCCCTCCAGCCCCCAGCCCGG + Intergenic
1153254292 18:3155263-3155285 CCCACCTCTGCCCTCCAGCCTGG - Intronic
1153254451 18:3156647-3156669 CCCACCTCTGCCCTCCAGCCTGG - Intronic
1153480588 18:5543401-5543423 CCCGCCAGCCGCCACCCGCCCGG + Intronic
1153507105 18:5812188-5812210 CCCATCTCCCACCTTCTGCCAGG - Intergenic
1153605471 18:6827642-6827664 CCCCCCCCCCACCTCCCTCCTGG + Intronic
1153782805 18:8509286-8509308 TGCACCTGCCGCCTCCCACCAGG - Intergenic
1153786169 18:8537336-8537358 CCCACCTCCAGCCCCCTACCTGG + Intergenic
1154439268 18:14373164-14373186 CCCACCTCCCCCATCCCTACAGG - Intergenic
1155392745 18:25352377-25352399 CGCCCCTCGCGCCGCCCGCCCGG + Intergenic
1155919205 18:31586168-31586190 TCCACCCCCCGCCTTCCCCCCGG - Intergenic
1157502698 18:48202469-48202491 GCCACCCCCCGCCCCCCACCTGG - Intronic
1157617008 18:48992942-48992964 TCCACCTCCCTCCACCAGCCTGG + Intergenic
1158079873 18:53577168-53577190 GTCACCTCCCACCTCCCACCAGG - Intergenic
1158380013 18:56919314-56919336 CCCTCCTCCCACTTCCTGCCTGG + Intronic
1158838768 18:61360516-61360538 CCCTCCCCTCGCCTCCTGCCTGG - Intronic
1158964502 18:62611279-62611301 CCCACCTGCCGCCTACTCCCCGG + Intergenic
1159007028 18:63022554-63022576 GCCCCTTCCCGCCTACCGCCCGG + Intergenic
1159337768 18:67091798-67091820 CCCACCTCCCACCCCACGACAGG - Intergenic
1160230461 18:77044577-77044599 CCCACCTCCCTCCTCGCACCTGG + Intronic
1160508593 18:79440991-79441013 CACACCTCCCTCCTCCAGGCAGG + Intronic
1160735296 19:659535-659557 GCCACCTCCCTGCGCCCGCCTGG + Intronic
1160748923 19:724658-724680 CCCACCACCCTACTCCAGCCTGG - Intronic
1160762291 19:791728-791750 CCCCCCTCCCCCCTCCCCCCGGG - Intergenic
1160806672 19:995047-995069 ACCAGCTCCCTCCTCCTGCCTGG - Intronic
1160826230 19:1081803-1081825 CCCACCCCCGGGCTCCCGCAGGG + Exonic
1160854767 19:1211770-1211792 CCCACCTCCCACCTCCTGGCTGG - Intronic
1160861832 19:1240405-1240427 CCGACCCCCCACCTCCTGCCTGG - Intergenic
1160947968 19:1652272-1652294 CGCGCCCCCCGCCCCCCGCCGGG + Intronic
1161007501 19:1943876-1943898 TCCACCACCCGCCCTCCGCCAGG - Intronic
1161092935 19:2371840-2371862 CGGACTTCCTGCCTCCCGCCTGG + Intergenic
1161241147 19:3224648-3224670 CGCGCCTCCCGCCTCCCTCCCGG - Intergenic
1161256817 19:3314289-3314311 CCCCCCTCCCGCCCCCCGGAAGG - Intergenic
1161296385 19:3522669-3522691 CCCAGCCCCCGCCTCCCTCCTGG + Intronic
1161332176 19:3693566-3693588 GCCGCCTGCCGCCTGCCGCCTGG - Intronic
1161623450 19:5311566-5311588 CCCACCCCCAGCCTCCACCCAGG - Intronic
1161664515 19:5567533-5567555 CCCACCTCGCGCTGCCCGCCCGG - Intergenic
1161714434 19:5867309-5867331 CCAACCTCCCGCCCCCCACCAGG - Exonic
1161767609 19:6216071-6216093 CCCTCCCCCCACCTCCAGCCTGG + Intronic
1161846295 19:6713630-6713652 CCCACCTCCAGCCCCTCACCTGG + Intronic
1161846328 19:6713701-6713723 CCCACCTCCAGCCCCTCACCTGG + Intronic
1161957713 19:7505889-7505911 CCCACCTCCTCCCTCCCCCCCGG + Intronic
1161959704 19:7516614-7516636 CCCACCTCCCGCCTGGGGTCTGG + Intronic
1162056176 19:8065566-8065588 CCAACCCCCTGCCCCCCGCCAGG + Exonic
1162110364 19:8396708-8396730 CCTCCCTCCCGCCCCCCCCCCGG - Intronic
1162257040 19:9498831-9498853 CCCACCTCCAGCCCCGCCCCCGG - Intergenic
1162525011 19:11201848-11201870 CTCACCTCCCCACCCCCGCCAGG + Intronic
1162582612 19:11540039-11540061 CCCACCTCCCCCCACTCACCCGG + Intronic
1163009727 19:14417481-14417503 CCCCCCTCCCCCCACCCACCCGG - Intronic
1163135498 19:15308146-15308168 CCCACCCCCCCCCCCCCCCCCGG - Intronic
1163321150 19:16575886-16575908 CCCGCCCCCTCCCTCCCGCCTGG + Exonic
1163371951 19:16906030-16906052 CGCATCCCCCGCCTCCGGCCAGG - Intronic
1163665884 19:18604006-18604028 CCCACCCACCGCTTCCTGCCTGG + Intronic
1163667656 19:18610798-18610820 CCCGCCTGCCGCCCCCAGCCAGG + Intronic
1163893680 19:20039112-20039134 CCGTTCTCCCGCTTCCCGCCCGG - Intronic
1164066519 19:21721330-21721352 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1164192064 19:22926082-22926104 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1164448326 19:28336686-28336708 CCCACATCCCCCCGCCCACCGGG - Intergenic
1164613238 19:29647776-29647798 CCCACCTCTCACCTCCAGCCTGG - Intergenic
1165129849 19:33624899-33624921 CCCATCTCCTGCCTGCTGCCTGG + Intronic
1165157750 19:33798073-33798095 CCCCCCTCCCGCCTCCGCCGCGG - Intronic
1165323134 19:35098680-35098702 TCCTCCTCCTGCCTCCCCCCTGG - Intergenic
1165356256 19:35305991-35306013 CCCACCCCCCCACTCCAGCCTGG + Intronic
1165356277 19:35306073-35306095 CCCACCCCCCTACTCCAGCCTGG + Intronic
1165432785 19:35781939-35781961 GCCACCTCCTGCCTCCCTCTTGG - Intronic
1165742104 19:38210718-38210740 CCCGGCTCCCGCCTCCCTCCCGG + Intergenic
1166162607 19:40965439-40965461 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1166163065 19:40966523-40966545 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1166301509 19:41914168-41914190 CCCACCTCCCATCTGCCTCCTGG + Intronic
1166334157 19:42095492-42095514 CCCACCGCCCGCCACCCCTCAGG + Intronic
1166425794 19:42676647-42676669 CTGACCCCCCGCCTCCCTCCCGG + Intronic
1166612111 19:44207686-44207708 CCCAACTCCAGCCTCCCAGCTGG - Intronic
1166667465 19:44689607-44689629 CCCTGCCCCAGCCTCCCGCCTGG + Intergenic
1166721800 19:45001423-45001445 GCCCCCGCCCGCCGCCCGCCCGG + Exonic
1166745575 19:45140411-45140433 CCAACCTCCCACCCCCCACCAGG - Intronic
1167056386 19:47113478-47113500 TCCACCTCCTGCCACCCACCCGG - Intronic
1167159441 19:47757360-47757382 TTCACCTCCCACCTCCGGCCAGG - Intergenic
1167247610 19:48383157-48383179 TCCCCATCCCGCCTCCTGCCGGG - Exonic
1167295168 19:48645516-48645538 CCCACCTCCACCCTCCCTCGGGG + Intronic
1167369459 19:49072012-49072034 CCCACGCCCCGCCTCTCACCGGG + Exonic
1167471454 19:49678161-49678183 CCCTCCTCCCTCCGCCCGCCAGG - Intronic
1167548117 19:50141172-50141194 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1167587643 19:50384014-50384036 CCCCCCGCCCGCCTCTCGCCCGG - Intergenic
1167894601 19:52570776-52570798 CCCACCTCCCGCCTCATGCTGGG + Exonic
1167898660 19:52601805-52601827 CCCACCTCCCTTCTCGTGCCGGG + Intronic
1167903244 19:52637840-52637862 CCCACCTCCCTCCTCGTGGCGGG - Intronic
1167909423 19:52689956-52689978 CCCACCTCCCTCCTCGTGCCGGG - Intronic
1167937942 19:52922895-52922917 CCCACCTCCCTCCTCATGCCGGG - Intergenic
1167940436 19:52942161-52942183 CCCACCTCCCTCCTCGTGCCGGG - Intronic
1167970672 19:53186926-53186948 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1167970776 19:53187156-53187178 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1167970971 19:53187594-53187616 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1167987921 19:53334151-53334173 CCCACCTCCCTCCTCGTTCCAGG + Intronic
1167991736 19:53366212-53366234 CCCACGTCCCTCCTCATGCCGGG + Intronic
1168003628 19:53468230-53468252 CCCACCTCCCTCCTCCTGCCGGG + Intronic
1168258609 19:55180365-55180387 CCCTCCTCCCGCCTCCACCCGGG + Exonic
1168695954 19:58404868-58404890 CCCCCCCCCCACCTCCCTCCTGG + Intronic
924962497 2:46680-46702 CCCGCCTCCTCACTCCCGCCCGG + Intronic
925327340 2:3033537-3033559 CCCACCTCCGACCTCTCCCCTGG - Intergenic
925403499 2:3591135-3591157 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
925414987 2:3663414-3663436 CCCTCCTCCCGACTTCCGACAGG - Intronic
926141015 2:10368462-10368484 CCCAGCTCCCAGCTCCGGCCTGG + Intronic
926147371 2:10404920-10404942 CGCAGCCCCCACCTCCCGCCGGG + Intronic
926150703 2:10424209-10424231 CCCACATCCCGTCTCCCGCTGGG - Intronic
926212463 2:10880837-10880859 CCATACCCCCGCCTCCCGCCTGG + Intergenic
926250950 2:11155300-11155322 CCCGCCCCGCCCCTCCCGCCCGG - Intronic
926250967 2:11155329-11155351 CCCGCCCCGCCCCTCCCGCCCGG - Intronic
927492643 2:23530767-23530789 CCCAGCTCCCACATCCCTCCTGG + Intronic
927714085 2:25341532-25341554 CCCCCCTCCCCGCCCCCGCCCGG - Intronic
927784008 2:25959821-25959843 CCCACCCCACCCCTCCTGCCAGG - Intronic
928003200 2:27540528-27540550 CCCCCCCCCCACCTCCCTCCCGG + Intronic
928005234 2:27557640-27557662 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
928005338 2:27557870-27557892 CCCCCCTCCCCCCTCCCGGACGG + Intronic
929811508 2:45192876-45192898 CCCACTCCCCACCTCCCACCAGG - Intergenic
929996170 2:46827633-46827655 GCCACCTCCCTGCCCCCGCCAGG + Intronic
930079094 2:47433050-47433072 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
930727887 2:54699136-54699158 CCGACCCCCCACCTCCCTCCCGG - Intergenic
931309690 2:61066215-61066237 CCCGCGTCCCGTCACCCGCCCGG + Intronic
931692532 2:64847453-64847475 CCTTCCTCCCTCCTCCTGCCTGG - Intergenic
931694338 2:64860372-64860394 CCGACCTGCCACCTCCCTCCAGG + Intergenic
932257835 2:70302177-70302199 CCCACCGCCCTCCTCCCGCTTGG + Intergenic
932496707 2:72149101-72149123 CCCGCCGCCCGCAGCCCGCCCGG + Intergenic
933953470 2:87349637-87349659 ACCACCCCCCACCCCCCGCCCGG - Intergenic
934562077 2:95318546-95318568 CCCACCTCCCGGTTCCCCACAGG - Intronic
934737769 2:96698649-96698671 CCCAACACCCTCCCCCCGCCAGG + Intergenic
934763463 2:96868580-96868602 CCCACTTCCTGCCTCCCTCTTGG - Intronic
934993342 2:98936385-98936407 TCGCCCTCCCGCCTCCCGCGGGG - Intergenic
935196403 2:100819466-100819488 CCCGCCTCCCACCTGCCCCCGGG + Intergenic
935218201 2:100990883-100990905 CTTGCCTCCTGCCTCCCGCCAGG - Intronic
935630805 2:105211097-105211119 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
935692635 2:105744929-105744951 CCCTCCGCCCGCCGCCCGCTCGG - Exonic
936042597 2:109161197-109161219 CCCACCTCTCACCTGCCCCCAGG - Intronic
937168718 2:119844352-119844374 CCCCCCCCCCACCTCCCTCCCGG + Intronic
937919535 2:127119938-127119960 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
938088709 2:128418376-128418398 CGCCCCCCCCGCCTCCCTCCCGG + Intergenic
938320588 2:130359677-130359699 CCCTCCTCCCTCCTCCCACAAGG - Intronic
938534186 2:132222031-132222053 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
939380523 2:141429639-141429661 CCCACCTCCCGCCCTCCAACAGG + Intronic
940643612 2:156369137-156369159 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
940751231 2:157628875-157628897 CCCACCACCCGCTCCCCGCCCGG - Exonic
940942814 2:159581915-159581937 CCCCCCTCCCCCCACCCGACAGG - Intronic
942481126 2:176389296-176389318 CCCACCTCCCCCATCCTGTCTGG + Intergenic
943105750 2:183544025-183544047 CCCACCCCCCACCACCCCCCTGG - Intergenic
943272534 2:185825428-185825450 CTCACCTCCCTCCTCCCTTCTGG - Intronic
943395671 2:187329560-187329582 CCAACCACCCACCTCCCACCAGG - Intergenic
943739921 2:191398250-191398272 CCCCCCTCCCCCCTCCCGGACGG + Intronic
944060734 2:195568039-195568061 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
944598525 2:201283050-201283072 CCCCCCTCCCCCCTCCCGGACGG + Intronic
944598796 2:201283690-201283712 ACCCCCCCCCGCCTCCCTCCCGG + Intronic
945063008 2:205924891-205924913 CCCACTTCCCGCCTCTGTCCAGG - Intergenic
945225915 2:207530587-207530609 CCCGCCGCCCGCCTCGCCCCCGG + Intronic
945233158 2:207611082-207611104 CCCCCCCCCCGCCTCCCTCCCGG - Exonic
945404013 2:209423823-209423845 CCCACCTCGCGGTCCCCGCCTGG + Intergenic
945835612 2:214835095-214835117 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
945970362 2:216226569-216226591 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
946282222 2:218673982-218674004 CCCACCTCCGACCTCTCTCCAGG + Intronic
946404792 2:219486589-219486611 CCCACCTGGGGCCTCCCTCCCGG + Intronic
946751042 2:222896202-222896224 CCCCCCCGCCGCCTCCCTCCCGG + Intronic
946855305 2:223944880-223944902 CCCACCGCGCCCCTCCAGCCCGG - Intronic
947857223 2:233332328-233332350 CCCACCTCCAGCCCCCCGAGAGG + Intronic
948542842 2:238702548-238702570 CCCATCTCCAGGCTCCCGGCCGG + Intergenic
948722344 2:239908939-239908961 CCCAGCTCCCGCATCCCCTCTGG + Intronic
1168963676 20:1886089-1886111 CTCATCTCCCGCCTCACTCCTGG + Intergenic
1168965434 20:1895336-1895358 CCCCCTTCCCCCCTCCCGGCTGG - Intronic
1169120586 20:3093315-3093337 CCCACCTCACCCCTCCAACCTGG + Intergenic
1169246925 20:4032743-4032765 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1169247102 20:4033131-4033153 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1169247131 20:4033184-4033206 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1169265017 20:4162185-4162207 CACACCTCCCGCCTCCGCTCAGG - Intronic
1169464720 20:5827301-5827323 CCCTCCTTCCACCTCCTGCCAGG + Intronic
1169799493 20:9500367-9500389 CCCTCCTCCAGCCTTCCCCCAGG + Intergenic
1169851233 20:10053722-10053744 CCCACCTGCCGCCTCCACCAAGG + Intronic
1170202563 20:13760651-13760673 CTGACCCCCCGCCTCCCTCCCGG - Intronic
1170424721 20:16227172-16227194 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1170889033 20:20364053-20364075 CGCCCTTCCCGCCGCCCGCCCGG + Intergenic
1171107977 20:22453867-22453889 CCCACCGGCCGCTCCCCGCCTGG - Intergenic
1171951752 20:31427364-31427386 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1171957054 20:31470608-31470630 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1171976055 20:31595368-31595390 CCCACCCACAGCCTCCTGCCGGG + Intergenic
1172034044 20:31999497-31999519 CCCACCTCCCGTCACCCTCGAGG - Exonic
1172118881 20:32586086-32586108 CCCACCGCCCCCCTCCTACCTGG + Intronic
1172269359 20:33645000-33645022 GCCGCCTGCCGCCTCCAGCCTGG - Exonic
1172611269 20:36254434-36254456 CCCCCTTCCCTCCTCCCACCAGG - Intronic
1172841043 20:37903021-37903043 CTCCCCTCCCTCCTCCCGCTCGG - Intergenic
1173521589 20:43704041-43704063 CCAGCCTCCAGCCTCCAGCCTGG - Intronic
1173579540 20:44137398-44137420 CCCGCCTCCCGCCCCTCCCCAGG + Intronic
1173734312 20:45348491-45348513 CCCGCCGCCCGCACCCCGCCCGG + Intergenic
1173852724 20:46228896-46228918 CGCCTCTCCCGCCTCCAGCCTGG + Intronic
1173869063 20:46330467-46330489 CCCACCACCCCACACCCGCCAGG - Intergenic
1173939140 20:46895007-46895029 CCCACCCCAGGCCGCCCGCCGGG + Intronic
1174157975 20:48528882-48528904 CCCACCTGCCTGCTCCTGCCTGG - Intergenic
1174204354 20:48828044-48828066 GCCCCCTCCCGCCCCTCGCCCGG - Intergenic
1174353286 20:49982923-49982945 CCCACCCCCCACCACCCCCCCGG + Intergenic
1174355063 20:49992010-49992032 CCCACCTCCTGCAACCCACCAGG - Intergenic
1174487599 20:50871058-50871080 CCCACCTCTCGCCCTCCGGCTGG - Intronic
1174505561 20:51015388-51015410 CCCATCTCCCCCCTCTCTCCTGG - Intronic
1175108106 20:56628724-56628746 CCTTCCTCTCTCCTCCCGCCCGG + Intergenic
1175237865 20:57525997-57526019 CCCACCCCTCGCCCCCCGCAGGG - Intergenic
1175439537 20:58981182-58981204 TCCAGGCCCCGCCTCCCGCCCGG + Intergenic
1175757970 20:61541877-61541899 CCCACCTCCTCCCTCCCTCAGGG + Intronic
1175847495 20:62066165-62066187 CCCGCATCCCGCGCCCCGCCCGG - Intergenic
1175875600 20:62227924-62227946 TCCACCCCCTGCCTCCCGCCTGG + Intergenic
1175883246 20:62272484-62272506 CCCTGCTGCCGCCTCCTGCCGGG + Intronic
1175957324 20:62618090-62618112 CCCACCTCCGGCTTCTCTCCCGG - Intergenic
1176053584 20:63133506-63133528 CCTGCCTCCCGCCTCTCTCCAGG + Intergenic
1176074600 20:63242776-63242798 CCCACCCCCCCCGTCCCCCCAGG - Intronic
1176253648 20:64139409-64139431 CCCCCCACCCGCCTTCTGCCAGG - Intergenic
1176265796 20:64208720-64208742 CCCACCTCCTCTCTCCCACCTGG - Intronic
1176921270 21:14690061-14690083 CTCACCTCCCGTCTGCAGCCAGG - Intergenic
1177989422 21:28019536-28019558 CGCACCTCCCTGCTCCAGCCGGG + Intergenic
1178533823 21:33396553-33396575 CCCGCCCCCCACCCCCCGCCTGG + Intergenic
1178922173 21:36745873-36745895 CCCACCTTCCACCTTCTGCCTGG - Intronic
1178922527 21:36747933-36747955 CGCACCCGCCGCCTCCGGCCTGG + Exonic
1179198045 21:39183830-39183852 CCCACCTCCTGGCGCCCGCAGGG - Exonic
1179209531 21:39313494-39313516 CCCGCCTCCCGCCCCGCGCCCGG - Exonic
1179932472 21:44579579-44579601 CCCAGCTCCTGCCTCCCAGCAGG - Exonic
1179979697 21:44889582-44889604 CCCGCCTGCCTCCTCCAGCCTGG + Intronic
1180174156 21:46079396-46079418 CCCTGCTCCCGGCTCCCTCCTGG + Intergenic
1180201456 21:46227282-46227304 CCCACCTTCCTCCTCCCTCAAGG + Intronic
1180791430 22:18577542-18577564 CCCACCGCCCGCGCCCCTCCGGG + Intergenic
1180960122 22:19758748-19758770 CGCACCGCCCGCCTCTGGCCAGG - Intronic
1181017658 22:20080453-20080475 CTTCCCTCCCGCCTCCCTCCGGG + Intronic
1181085541 22:20437832-20437854 CCCTCCTGCCGCCCCCCGCCCGG - Exonic
1181230309 22:21417769-21417791 CCCACCGCCCGCGCCCCTCCGGG - Intronic
1181248341 22:21517094-21517116 CCCACCGCCCGCGCCCCTCCGGG + Intergenic
1181586338 22:23855115-23855137 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1181586440 22:23855345-23855367 CCCCCACCCCGCCTCCCTCCCGG - Intergenic
1181680844 22:24494956-24494978 TCCCCCTCCCGCCTCCCTCAGGG - Intronic
1182538969 22:31027260-31027282 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1182697617 22:32207192-32207214 CCCAGCTCCAGCCTCCAGCATGG - Intergenic
1182731407 22:32498264-32498286 CCTAGCTCCCGCCTTCCTCCAGG + Exonic
1182761657 22:32727138-32727160 CCCACCTCCACCCTCCTGCAAGG + Intronic
1182903990 22:33920873-33920895 CCCGCCTCCCGCGCCCGGCCAGG + Intronic
1183508229 22:38220952-38220974 CCCACATCCCCACTCCTGCCCGG + Exonic
1183871524 22:40745140-40745162 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1183903271 22:41021924-41021946 CCCATGTCCCGGCTCCGGCCAGG - Intergenic
1184033529 22:41908206-41908228 CCCACCTCCCACCCCCTGCTGGG - Intergenic
1184106737 22:42371745-42371767 CCCTCCTCCCTCTTCCTGCCTGG + Intergenic
1184202699 22:42981468-42981490 CCCCCCCGCCGCCTCCCTCCCGG - Intronic
1184242122 22:43216857-43216879 CCCCCCACCCACCCCCCGCCAGG + Intronic
1184254618 22:43280054-43280076 CCCACCTTCCTCCTCCTGACTGG - Intronic
1184274162 22:43400656-43400678 GCCACCACCCGCCGCCAGCCCGG - Intergenic
1184357842 22:43994451-43994473 CCCACCTCCCACCACACGCCAGG - Intronic
1184589280 22:45470847-45470869 CCCCCCTCCCCCCTCCCCGCTGG + Intergenic
1185272382 22:49935319-49935341 CCCGCGCCCCGCCGCCCGCCCGG - Intergenic
1185333275 22:50261037-50261059 CCCACGGCCCGACCCCCGCCCGG + Intronic
1185409359 22:50674236-50674258 CACACCTCCCGCCCCCACCCGGG + Intergenic
949105444 3:196980-197002 CCCCCGTCCCGGCTCCCGGCCGG + Exonic
949569954 3:5283857-5283879 CTCCCCCCCCGCCTCCCTCCTGG + Intergenic
950282336 3:11719295-11719317 GCCACCTCCTCCCTCCCGCAGGG + Intronic
950683744 3:14602493-14602515 GCCACCTCCCGACACCCGGCGGG + Intergenic
951217837 3:20040876-20040898 CCTGCCTCTCGCCTCCCGCCTGG + Intronic
952494618 3:33904937-33904959 CCCACATTCTGCCTCCCACCAGG - Intergenic
952887831 3:38022351-38022373 GCCACCTCCGGCCTCCGGCGGGG + Intronic
952888942 3:38028733-38028755 CCAACCTCCCGCCTCCCAGAAGG + Intronic
953257624 3:41306116-41306138 CCCCCCCCCCACCTCCCTCCCGG - Intronic
953287859 3:41630261-41630283 TCCACCTCCAGCCTCCAGACTGG - Intronic
954059663 3:48056828-48056850 CCCCCCCCCCACCTCCCTCCCGG - Intronic
954080677 3:48211424-48211446 CCCCCCCCCCACCTCCCTCCTGG - Intergenic
954110251 3:48429499-48429521 CCCTCCCCCCGCCCGCCGCCCGG + Intronic
954126904 3:48536661-48536683 CCCATCTCCCGTCTCCCACAGGG - Intronic
954246930 3:49339678-49339700 CCCTCCTCCTGGCCCCCGCCGGG + Intronic
954378031 3:50205177-50205199 CCCTCCTCCCGCGGGCCGCCAGG + Intergenic
954609391 3:51936392-51936414 CAGACCTCCCGCCTGCCCCCAGG + Intronic
954692548 3:52403356-52403378 GCCACTTCCCTCCTCCCTCCTGG + Intronic
955368728 3:58332914-58332936 GCCGACTCCCGCCGCCCGCCCGG - Exonic
956178080 3:66493077-66493099 CCCTCCTCCCTCCTCCCTCAAGG + Intronic
956497385 3:69842960-69842982 CACACCTCCAGACTCCAGCCAGG - Intronic
956513671 3:70022273-70022295 CCCTCCTCCCTCCCCCCACCCGG - Intergenic
959201646 3:103254954-103254976 CTGACCTCCCACCTCCCTCCCGG + Intergenic
959415152 3:106073617-106073639 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
959415494 3:106074402-106074424 ACCCCCCCCCGCCTCCCTCCCGG + Intergenic
960780552 3:121313608-121313630 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
960896742 3:122514368-122514390 CCCGCCTCCCGCCCGCCGCCCGG + Intronic
961574472 3:127823269-127823291 CGCGCCGCCCGCCGCCCGCCGGG - Intergenic
961649607 3:128410841-128410863 CCCACCTCTCACCTCCCTACTGG + Intergenic
962873807 3:139520215-139520237 CCCACCCCAGGCCTCCCACCTGG + Intronic
962919312 3:139936160-139936182 ACCTCCCCGCGCCTCCCGCCCGG + Intronic
963225993 3:142862112-142862134 CCCACCTTCTCCCTCCAGCCTGG - Intronic
963244561 3:143047326-143047348 CCCCCCTCCCCCCTCCCGGACGG + Intronic
963244691 3:143047630-143047652 CCCCCCTCCCGCCTCCCGGACGG + Intronic
963498461 3:146096868-146096890 CCCCCCCCCCACCTCCCTCCCGG - Intronic
963911231 3:150820201-150820223 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
963911531 3:150820851-150820873 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
964356241 3:155854268-155854290 CACACCTCCAGCCTCGAGCCCGG - Exonic
964918257 3:161861893-161861915 CCAACCTCCAGTCTCCTGCCTGG - Intergenic
965873336 3:173286658-173286680 GCCAGCGCCCGCCACCCGCCTGG - Intergenic
966359605 3:179120053-179120075 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
966360171 3:179121330-179121352 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
966420027 3:179727799-179727821 CCCCCCCCCCACCTCCCTCCCGG + Intronic
966783867 3:183608152-183608174 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
966784225 3:183608956-183608978 CCCCCCCGCCGCCTCCCTCCCGG - Intergenic
967055016 3:185824003-185824025 CCGTCCCCCCGCCTCCCGCTCGG - Intronic
967176171 3:186864517-186864539 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
967176227 3:186864648-186864670 CCCCCCCCCCGCCTCTCTCCCGG - Intergenic
967242580 3:187455539-187455561 CCCTCCTCTCGCCTCCCTACTGG + Intergenic
968232173 3:197010656-197010678 CCCACCTCCCGGCTGAGGCCAGG + Intronic
968288838 3:197523730-197523752 TGCCCCTCCCACCTCCCGCCAGG - Intronic
968609679 4:1551297-1551319 CCCACCTCCCACCTGCCCACCGG - Intergenic
968610975 4:1556848-1556870 CCCACCCCCTGCCTCTCTCCTGG + Intergenic
968616620 4:1580505-1580527 GACCCCACCCGCCTCCCGCCCGG + Intergenic
968662082 4:1802843-1802865 CCCACATCCTGCCTCGTGCCCGG + Intronic
968667250 4:1828510-1828532 CCCCCCCCCCACCTCCCTCCCGG + Intronic
968667542 4:1829172-1829194 CCCCCCCCCCACCTCCCTCCCGG + Intronic
968700855 4:2057796-2057818 CCCGCCTCCCCACTCACGCCCGG + Intergenic
968703258 4:2066569-2066591 CCCACCTCATCCCTCCAGCCTGG + Exonic
968744725 4:2353754-2353776 CCCACCCCACGCATCCTGCCCGG + Intronic
968811328 4:2800822-2800844 CCCACCTGCAAACTCCCGCCTGG - Intronic
969044664 4:4328028-4328050 CCCACCTCCCAGCTCCCAACAGG + Intergenic
969318188 4:6394791-6394813 CCCATCGCCCGCCTGCCGGCTGG - Intronic
969415153 4:7053107-7053129 CCCACCTGCCTCTGCCCGCCTGG - Intronic
969705269 4:8788313-8788335 CTCATCTCCTGCCTCCTGCCCGG - Intergenic
969713402 4:8857380-8857402 CCCGCCTCCTGCCTCCTACCTGG - Intronic
970409383 4:15791284-15791306 CCCCCCTCCCCCCTCCCGGACGG - Intronic
971421944 4:26481723-26481745 CCCACCTCTCCCCTCGCCCCTGG + Exonic
972288367 4:37669169-37669191 CCCCCCCCCCACCTCCCTCCCGG - Intronic
972466948 4:39366409-39366431 CGCACCTCCCGCCTCTGGGCGGG - Intergenic
972912584 4:43836313-43836335 CACACCTCCTCCCTCCAGCCTGG - Intergenic
973660975 4:53105877-53105899 CCCACCCCCCGCCTCCTGACTGG + Intronic
974895003 4:67927568-67927590 CCCACCTTCCGCTACCAGCCTGG - Intronic
975685713 4:76917158-76917180 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
975686116 4:76918059-76918081 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
976265639 4:83185404-83185426 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
980130581 4:128812371-128812393 CGCGGCTCCCGCCGCCCGCCGGG - Intronic
980892649 4:138831673-138831695 CCAGCCTCCAGCCTCCAGCCTGG - Intergenic
982107877 4:152026427-152026449 CCCAGCTCCCCCCTCCCCCCGGG - Intergenic
982186443 4:152806393-152806415 CACACCTCCCGCCACCAGACTGG + Intronic
982564659 4:156971867-156971889 CCCACCTCCTGTCTGCCGCCCGG - Intergenic
982615958 4:157637234-157637256 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
982709620 4:158746513-158746535 CTGACCCCCCACCTCCCGCCCGG + Intergenic
982712170 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG + Intergenic
983652405 4:170046923-170046945 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
984803782 4:183735935-183735957 CGCCCCCCCCGCCTCCCTCCCGG + Intergenic
984804011 4:183736464-183736486 CCCCCCTCCCCCCTCCCGGATGG + Intergenic
984804105 4:183736675-183736697 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
985657485 5:1139724-1139746 CCCACGTCCCTCCTCCCGGCAGG + Intergenic
986191729 5:5502707-5502729 CCCACCTTCCTCCTCCTGCTTGG - Intergenic
987169041 5:15234138-15234160 CCCACCTCCCCTCTCCAGGCAGG + Intergenic
987327275 5:16823765-16823787 CCCGCCCCCCGCCCCCAGCCAGG - Intronic
988552348 5:32208864-32208886 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
988796583 5:34657233-34657255 CCCACCCCCCACCCCCCACCAGG - Intronic
988825350 5:34929790-34929812 CCCAGCGCCGGCCGCCCGCCCGG + Exonic
989061564 5:37415667-37415689 CCCCCCACCTCCCTCCCGCCGGG + Intronic
989587558 5:43087325-43087347 CCCCCCCGCCGCCTCCCTCCCGG + Intronic
990382713 5:55232550-55232572 CCCGCCTCCCCCCTCCTTCCCGG - Intronic
991073652 5:62513415-62513437 CCCCCCCCCCACCTCCCTCCCGG + Intronic
992052758 5:72956242-72956264 TCCTCCTGCCGCGTCCCGCCTGG + Intronic
992374157 5:76172276-76172298 CCCCCCCCCCACCTCCCTCCCGG - Intronic
992964017 5:81983237-81983259 CCCCCCCCCCACCTCCCTCCTGG + Intronic
992978428 5:82140583-82140605 CCCCCCCCCCACCTCCCTCCCGG - Intronic
995190231 5:109311836-109311858 ACCCCCTCACGCCCCCCGCCAGG - Intergenic
995193942 5:109342866-109342888 CCCCCCCCCCACCTCCCTCCCGG - Intronic
996082196 5:119268690-119268712 CCGACCTCCCGGCTCCTCCCCGG + Intronic
996097217 5:119411630-119411652 CCCACCCCCTACCCCCCGCCCGG + Intergenic
997302000 5:132813389-132813411 CCCACCCCCAGCGCCCCGCCGGG - Intergenic
997408253 5:133669585-133669607 CCCACCTGCCTCCTTCAGCCAGG + Intergenic
997892340 5:137687234-137687256 CCCCCCCCGCGCCTCCCTCCCGG - Intronic
998131856 5:139655430-139655452 GCCACCCCCCGCCGCCCCCCTGG + Intronic
998150693 5:139756029-139756051 CCGCCCTCCCGCGCCCCGCCAGG + Intergenic
998206026 5:140157425-140157447 CCCACCCCCCGCCCCCTGTCAGG - Intergenic
998406740 5:141878491-141878513 CCTCCCTCCCCCCTCCCTCCCGG + Intronic
998431622 5:142075286-142075308 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
998431833 5:142075714-142075736 CCGACCCCCCACCTCCCTCCCGG + Intergenic
999105002 5:149063104-149063126 CCCTCCTCCCGCCTCCTCCCTGG + Exonic
999575105 5:152967387-152967409 CCCACCTCCCGCCACCTTCATGG + Intergenic
1000805766 5:165789541-165789563 TACACCTCCCGCCCCCCGCCCGG + Intergenic
1001083774 5:168685799-168685821 CCCACCTGCCGCTGCCCACCAGG - Exonic
1002000909 5:176195849-176195871 CCCACCTCCTACCTCACCCCAGG - Intergenic
1002253425 5:177943123-177943145 CCCACCTCCTACCTCACCCCAGG + Intergenic
1002277576 5:178113801-178113823 CCCACCCCCCGAGTCCAGCCCGG - Intronic
1002296148 5:178232465-178232487 CCCGCCGCCCGCCCCCCGCCCGG + Intronic
1002330628 5:178437869-178437891 CCCACATCCCACCTCCCCCCAGG - Intronic
1002896494 6:1383104-1383126 CCCAACTCCCGCCTCCACCTTGG - Intergenic
1003218568 6:4136231-4136253 CCCACCTCCCGGCTCAGGGCTGG - Intergenic
1003319354 6:5037820-5037842 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1003427361 6:6006656-6006678 CCCGCCTCCAGCCTCCAGCCGGG + Intronic
1003511098 6:6781289-6781311 CCCTCCCCCAGCCTCCTGCCAGG - Intergenic
1004388374 6:15189623-15189645 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1004640791 6:17513641-17513663 GCCACCTGCCGCCTCCCCTCAGG + Intronic
1004647844 6:17580380-17580402 CCCGCCTCCCGCCTCCCAAAGGG + Intergenic
1004853068 6:19720107-19720129 CCCAGCTCCTGTCTCCAGCCTGG - Intergenic
1005069747 6:21851902-21851924 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1005069845 6:21852125-21852147 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1005837284 6:29718879-29718901 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1005837381 6:29719093-29719115 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1005986874 6:30881215-30881237 CACACCTCCAGCCTCCAGCCGGG - Intronic
1006047350 6:31308716-31308738 CCTCCCTCCCACGTCCCGCCCGG + Intronic
1006232090 6:32595323-32595345 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1006639645 6:35483381-35483403 TCCAGGTCCCGCCTCCAGCCTGG + Intronic
1006844290 6:37051732-37051754 CCCACCTCCTTCCTCCCACAGGG + Intergenic
1006860832 6:37170663-37170685 AGCACCCCCCGCCTCCGGCCCGG + Intronic
1007072702 6:39048757-39048779 CCCACCGCCCGCCACCAGCCCGG + Intergenic
1007287025 6:40755076-40755098 CCCACCTCCCACTCCCCGCTAGG - Intergenic
1007429349 6:41767747-41767769 CCCACCCACCCCTTCCCGCCAGG + Intergenic
1009245123 6:61227914-61227936 CCCACCACCCCCCCCCCGACAGG - Intergenic
1009366967 6:62863604-62863626 CCCACTCCCCCCCACCCGCCCGG + Intergenic
1014551027 6:122789655-122789677 CCCAGCCCCGGCCTCCCGGCTGG - Intronic
1014557100 6:122849407-122849429 ACCCCCTCCCACCTCCCTCCCGG + Intergenic
1014764011 6:125388800-125388822 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1014764162 6:125389141-125389163 CCCCCCCCCGGCCTCCCTCCCGG + Intergenic
1015476691 6:133664866-133664888 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1017137559 6:151161652-151161674 CCCACCTCCCGCTGCTGGCCTGG - Intergenic
1017954803 6:159169255-159169277 CGCCCCGCCCGCCTCCAGCCCGG + Intergenic
1018419672 6:163630872-163630894 CCCATCTGCCGCCTCCCGCCCGG - Intergenic
1019112104 6:169724531-169724553 CCCACCTCCCGCCCGCCCTCCGG + Intronic
1019323193 7:424889-424911 CACACATCAGGCCTCCCGCCTGG + Intergenic
1019350418 7:551745-551767 CCAAACCCCCACCTCCCGCCCGG + Intronic
1019350478 7:551930-551952 CCAAACCCCCACCTCCCGCCCGG + Intronic
1019350590 7:552297-552319 CCAAACCCCCACCTCCCGCCCGG + Intronic
1019350611 7:552359-552381 CCAAACCCCCACCTCCCGCCCGG + Intronic
1019356856 7:584748-584770 CCCACCTCCCTCCTCCCGGGGGG + Intronic
1019422935 7:959407-959429 CCCTCCACCGGCCCCCCGCCAGG - Intronic
1019439685 7:1039401-1039423 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1019458828 7:1146458-1146480 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1019459052 7:1146976-1146998 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1019492838 7:1323169-1323191 CCCTCCACGCGCCTCCCACCCGG + Intergenic
1019528598 7:1492833-1492855 CCCCACTCCCCACTCCCGCCCGG - Intronic
1019528615 7:1492874-1492896 CCCCGCTCCCCACTCCCGCCCGG - Intronic
1019528628 7:1492908-1492930 CCCCGCTCCCCACTCCCGCCCGG - Intronic
1019528656 7:1492976-1492998 CCCCGCTCCCCACTCCCGCCCGG - Intronic
1019618958 7:1980251-1980273 CCCACCTCCCCCCACCCCACAGG + Intronic
1019777824 7:2923018-2923040 TCCAGCTCCCTCCTCCTGCCCGG + Intronic
1019779380 7:2930504-2930526 CCCACCACCCCCTCCCCGCCAGG - Intronic
1020616507 7:10465984-10466006 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1020785669 7:12570317-12570339 CTCACCTCACCCCTCCTGCCAGG + Intergenic
1021200848 7:17727143-17727165 CCCAACCCCCACCTCCCGACAGG - Intergenic
1021440258 7:20668578-20668600 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1021735353 7:23636757-23636779 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1021735802 7:23637783-23637805 CCCCCTCCCCGCCTCCCTCCCGG - Intronic
1021813678 7:24427367-24427389 CCTTCCTCCAGCCTCCTGCCAGG - Intergenic
1021872676 7:25019399-25019421 ACCACCCCCCACCTCCCTCCCGG - Intergenic
1022065985 7:26858186-26858208 CCCATCTCCTGCCTCCGGGCCGG + Intronic
1022097109 7:27147972-27147994 CCGCCCGCCCGCCGCCCGCCCGG + Intronic
1022480394 7:30739780-30739802 CCCTCCTCCAGGCTCCCACCAGG - Intronic
1022505218 7:30905477-30905499 CCCACCCCGCACCTCCAGCCAGG - Intergenic
1022663587 7:32387861-32387883 CCCCCCTCCCCCCTCCCGGACGG + Intergenic
1024045443 7:45582564-45582586 ACCACCCCCCACCCCCCGCCAGG - Intronic
1024243459 7:47452895-47452917 CCCACGTGCCGCCTCTCGGCTGG - Intronic
1025130293 7:56371362-56371384 CCCAGCTCCTGCCTCCCAGCAGG + Intergenic
1025130613 7:56372660-56372682 CCCAGCTCCTGCCTCCCAGCAGG + Intergenic
1025176344 7:56804247-56804269 CCCAGCCTCTGCCTCCCGCCTGG + Intergenic
1025182781 7:56832076-56832098 CCCAGCTCCTGCCCCCCGACAGG - Intergenic
1025689145 7:63744898-63744920 CCCAGCTCCTGCCCCCCGACAGG + Intergenic
1025695450 7:63772175-63772197 CCCAGCCTCTGCCTCCCGCCTGG - Intergenic
1025852930 7:65258414-65258436 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1025853072 7:65258726-65258748 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1025853256 7:65259127-65259149 CCCCCCTCCCCCCTCCCGGACGG - Intergenic
1025853339 7:65259307-65259329 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1025979244 7:66393654-66393676 ACCCCCGCCCGCCTCCCTCCCGG + Intronic
1025979452 7:66394126-66394148 CCCCACCCCCGCCTCCCTCCCGG + Intronic
1026010038 7:66629213-66629235 CCCGCGGCCCGCCGCCCGCCCGG - Intronic
1026166817 7:67917514-67917536 TCCCCCTCCCGCCCCCTGCCAGG - Intergenic
1026650241 7:72210165-72210187 TCCACCTCCTGCCTCCTACCAGG + Intronic
1026736869 7:72954538-72954560 CCCACCTCCCGACCCCATCCGGG + Intergenic
1026787088 7:73308611-73308633 CCCACCTCCCGACCCCACCCGGG + Intronic
1027029051 7:74875032-74875054 CCCACCTCTGGGCTCCCGGCAGG - Intergenic
1027106865 7:75410525-75410547 CCCACCTCCCGACCCCATCCGGG - Intronic
1027231717 7:76276549-76276571 CCCACCTCCCACCCACAGCCTGG - Intronic
1027266413 7:76497404-76497426 CAGCCCTCCCGCCTCCCGTCTGG + Exonic
1027317793 7:76995522-76995544 CAGCCCTCCCGCCTCCCGTCTGG + Intergenic
1028684194 7:93574786-93574808 ACCCCCGCCCGCCTCCCGACAGG + Intergenic
1029441092 7:100586903-100586925 CCCCCCGCCCGCCCCCAGCCCGG - Intronic
1029456349 7:100674260-100674282 CCACCCTCCCGCCTGCCCCCGGG + Intronic
1029490697 7:100868509-100868531 GCCACCTCCTGCCTACCGCACGG + Exonic
1029538637 7:101170355-101170377 TCCACCTCCCCCCTCTCCCCGGG + Intergenic
1030022875 7:105293047-105293069 CCCCCCTCCCTCCTCCCCCTTGG - Intronic
1032569909 7:132985666-132985688 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1033301281 7:140188390-140188412 TCCACCTCCCCCACCCCGCCCGG - Intergenic
1033323794 7:140362406-140362428 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1033323904 7:140362661-140362683 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1033324007 7:140362889-140362911 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1034284068 7:149873305-149873327 CCAGCCCTCCGCCTCCCGCCGGG + Exonic
1034324753 7:150220385-150220407 CCCACCTCGCGTCTCCCCCGAGG - Intergenic
1034472446 7:151262667-151262689 CCCTCCTCCCTGCTCCCGCGGGG - Intronic
1034618067 7:152436018-152436040 CCCGCCCGCCGCCCCCCGCCCGG - Intergenic
1034638471 7:152585581-152585603 CCCCCCCCCCGCCTCCCTCCCGG + Intergenic
1034638769 7:152586247-152586269 CCCCCCCGCCGCCTCCCTCCCGG + Intergenic
1034723302 7:153314808-153314830 CCCCCCACCCACCTCCCTCCCGG + Intergenic
1034768438 7:153748846-153748868 CCCACCTCGCGTCTCCCCCGAGG + Intergenic
1034982809 7:155489589-155489611 CCCACCTCCCCACTTCAGCCAGG + Intronic
1035741322 8:1930370-1930392 CACACCGCCCAGCTCCCGCCTGG + Intronic
1036656732 8:10681784-10681806 CACAAGTCCCGCCTCCTGCCAGG - Intronic
1036737218 8:11330092-11330114 CTGACCTCCCACCTCCCTCCCGG - Intergenic
1036910757 8:12755368-12755390 GCCATCTCCCGACTCCCTCCTGG + Exonic
1037305134 8:17496969-17496991 CCCCGAGCCCGCCTCCCGCCGGG - Intergenic
1037675074 8:21044130-21044152 CCCACCTCCTACCTCCCACCTGG + Intergenic
1037928755 8:22865214-22865236 TCCCCCTCCCGCCGCCCCCCAGG - Intronic
1038328331 8:26589001-26589023 CCCACCTCCTGCCTCTCGCCAGG + Intronic
1038595291 8:28881460-28881482 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1039048582 8:33472774-33472796 CCCGGCACCCGCCTCCCGCCTGG + Intronic
1039362403 8:36892488-36892510 CCCACCCCCCACCCCCCACCAGG + Intronic
1039885112 8:41650068-41650090 GCCACCTCCCGGCACCCGCCAGG - Intronic
1040069683 8:43179536-43179558 CCCCCCCACCGCCTCCCTCCCGG + Intronic
1040069930 8:43180107-43180129 CCCCCCCACCGCCTCCCTCCCGG + Intronic
1041167258 8:55102316-55102338 GCCGCCGCCCGCCGCCCGCCGGG - Intergenic
1042591450 8:70402661-70402683 GGCCCCTCCCGCTTCCCGCCTGG + Intronic
1043606155 8:82003032-82003054 CCGAACTCCAGCCTCCAGCCTGG - Intergenic
1044692428 8:94894592-94894614 CCCACGTCCCGCCTCCCTCCTGG + Intronic
1044821921 8:96160848-96160870 GCCCCCTCCCGCCCCTCGCCGGG + Intergenic
1045120247 8:99028524-99028546 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1045120275 8:99028576-99028598 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1045320807 8:101080368-101080390 CCCACATCCTGTCTCCTGCCTGG - Intergenic
1045674212 8:104589492-104589514 CCCCCCTCCCCCCACCCGCTGGG - Intergenic
1046636403 8:116679101-116679123 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1046636821 8:116680023-116680045 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1046729030 8:117705349-117705371 CCCACCTCCTATCTCCCTCCAGG - Intergenic
1048315524 8:133359008-133359030 TCCACCTCCCACCTCCCTCCTGG - Intergenic
1048329739 8:133463597-133463619 CCCACCTCCCTACCCCAGCCGGG + Intronic
1048937009 8:139365731-139365753 CCTTCCTCCCCCCTCCCTCCAGG - Intergenic
1049394729 8:142394700-142394722 CCCACCTCCCTGCTCCAACCAGG + Intronic
1049407556 8:142458356-142458378 CCCGCCTCCCGCCGCCATCCTGG - Intronic
1049423047 8:142525268-142525290 CGCCTCTCCTGCCTCCCGCCTGG - Intronic
1049429704 8:142555045-142555067 CCCACCTCCCACCTCTGGGCAGG + Intergenic
1049529762 8:143148364-143148386 CTCACCTCCTGCATCCCACCAGG + Intergenic
1049597698 8:143492331-143492353 GCCACCTCCCTCCTCCCACCAGG + Intronic
1049750963 8:144283724-144283746 CCCACCACCAGCCTCCCTCATGG - Intronic
1049761304 8:144333031-144333053 CCCACCCCGCCCCGCCCGCCAGG - Exonic
1049883082 9:11159-11181 CCCCCCCCCCGCCCCCAGCCCGG - Intergenic
1050472535 9:6008023-6008045 CCCTCCTCTCCCCTCCCCCCCGG + Intergenic
1052858717 9:33423608-33423630 CCCCCCCGCCGCCTCCCTCCCGG - Intergenic
1052860424 9:33434816-33434838 CCCACCTCCCACCTCAAGCCAGG + Intergenic
1052997927 9:34561076-34561098 CCCACACGCCGCCTCCTGCCTGG + Intronic
1053157600 9:35791676-35791698 GCTTCCTCCCGCCCCCCGCCTGG - Intergenic
1053255705 9:36615072-36615094 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1054781942 9:69174022-69174044 GCCGCCTCCCGCCCCCGGCCAGG + Intronic
1055137063 9:72840483-72840505 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1055948300 9:81710396-81710418 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1055948709 9:81711305-81711327 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1056143426 9:83707148-83707170 CCCACCGCCAGCCTCCGGGCGGG - Intronic
1056604679 9:88076777-88076799 ACCACGTCCCTCCTCCCGCCTGG + Intergenic
1056670898 9:88626338-88626360 CCCCCCCCCCACCTCCCTCCCGG - Intergenic
1057178187 9:93014374-93014396 CCCACCTTCCCCCTCCCTCCCGG - Intronic
1057195687 9:93114743-93114765 TGCATCTGCCGCCTCCCGCCTGG + Intergenic
1057313312 9:93954752-93954774 TGCACCCTCCGCCTCCCGCCTGG + Intronic
1057547149 9:96027242-96027264 CCCCCCTCCCGCCTCCTGTGTGG + Intergenic
1057674406 9:97127339-97127361 CCCACTTCCCTCCTGCCCCCAGG - Intergenic
1058357009 9:104094523-104094545 CCCGCCTCCCGCCTCCCGCCAGG - Intronic
1058885925 9:109320971-109320993 CGCAGCCCCCGCCTCCCACCTGG + Intergenic
1059121199 9:111641662-111641684 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1059211040 9:112514338-112514360 CCGACCCCCCACCTCCCTCCCGG - Intronic
1060065259 9:120496367-120496389 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1060096299 9:120793479-120793501 CCCACCACCCACCTCCGGGCGGG - Intergenic
1060104618 9:120865959-120865981 CTCCCCTCCCTCCTCCCTCCTGG - Intronic
1060249117 9:121971251-121971273 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1060304244 9:122396469-122396491 CCCACCTCCCACCCTCCGACAGG - Intergenic
1060389554 9:123267495-123267517 ACCCCCTCCCGCCTCCCTGCAGG + Intronic
1060548519 9:124474619-124474641 CCCACCTGTGTCCTCCCGCCTGG + Intronic
1060651221 9:125328834-125328856 CCCCCCCCCCACCTCCCTCCCGG + Intronic
1060687087 9:125623692-125623714 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1060687490 9:125624598-125624620 CCCCCCCCCCACCTCCCTCCCGG - Intronic
1060941473 9:127545390-127545412 CCCAGCACCCAGCTCCCGCCAGG + Intronic
1061128002 9:128689069-128689091 CCTTCCTCCCACCTCTCGCCGGG + Intronic
1061264506 9:129497358-129497380 CCCCCCTCCCCGCCCCCGCCCGG - Intergenic
1061296075 9:129677497-129677519 CCCACCTCCCGGTTCCTGCCTGG + Intronic
1061415418 9:130444755-130444777 ACCTCCCCCCGCCTCCCACCAGG - Intergenic
1061666363 9:132162820-132162842 CTCACCTCCCGACCCCCTCCCGG - Intronic
1062004767 9:134233638-134233660 CCCGCCTGCCGCCACCCGTCAGG + Intergenic
1062088061 9:134658701-134658723 CCCACCCCCCGCCACCCTCCAGG - Intronic
1062093975 9:134693676-134693698 CCCGCCTCGCCCCTTCCGCCCGG + Intronic
1062252428 9:135605048-135605070 CCCAGGTCCCGCCTCCCTTCTGG + Intergenic
1062324862 9:136007933-136007955 CCTACCTTCCGCCTTCCTCCTGG + Exonic
1062391694 9:136336400-136336422 GCCACCCCCTGCCTCCCGCTGGG - Intronic
1062405201 9:136392939-136392961 CCCACCTCCAGGCTGCCACCGGG + Intronic
1062428127 9:136515452-136515474 CCCCCCGCCGGCCACCCGCCTGG + Intronic
1062452193 9:136620441-136620463 CCCCTCTCCGGCCTCCGGCCTGG - Intergenic
1062574268 9:137199272-137199294 CCTACCTCCCGCACCCTGCCAGG - Exonic
1062586913 9:137253649-137253671 CCCACCTCCCATCTCGCTCCAGG - Intergenic
1062634063 9:137480731-137480753 CCCAGCCCCCGCTTCCCGCCTGG - Intronic
1062680281 9:137775457-137775479 CCCATTTCCCTCCTACCGCCTGG + Intronic
1185621453 X:1453337-1453359 ACCCCCGCCCGCCTCCCCCCCGG + Intronic
1186345176 X:8684651-8684673 CCCACCCCCCGCCTTCCCCGAGG + Intronic
1186350258 X:8732428-8732450 CCCACCTTCCCCCTCCGTCCAGG + Intergenic
1188116395 X:26249598-26249620 CCCACCCCCCACCTCCCGACAGG - Intergenic
1188367675 X:29333800-29333822 CCCCCCCCCCGCCTCCCTCCCGG + Intronic
1189370707 X:40426901-40426923 CCCCACTCCAGCCTCCAGCCTGG + Intergenic
1189461086 X:41243532-41243554 CCCCCCCCCCGCCCCCCGCTCGG - Intergenic
1189837947 X:45041180-45041202 CCCCCCTCCCCCCTCCCGGACGG + Intronic
1190779088 X:53578563-53578585 CCCCCCTCCCCCCTCCCGGACGG - Intronic
1190779293 X:53579017-53579039 CCCCCCCCCCGCCTCCCTCCCGG - Intronic
1190932958 X:54965298-54965320 CCCACCTACCGCCTTCTTCCTGG - Intronic
1190984441 X:55488553-55488575 CCCCACCCCCGCCTCCAGCCCGG - Exonic
1191136465 X:57070095-57070117 CCCATCCCTCGCCTCCCGCCTGG + Intergenic
1191794091 X:65002385-65002407 CTGACCCCCCGCCTCCCTCCCGG - Intronic
1191861438 X:65668713-65668735 CCCTCCTCCCCTCTCCCTCCTGG - Intronic
1192190659 X:68989452-68989474 CCCACCTCCCCCTTACCCCCAGG - Intergenic
1192567900 X:72179172-72179194 CCCCCCCCCCGCCTCCCTCCCGG - Intergenic
1193152486 X:78139685-78139707 CCCTCCTCCCGCTCCCCGCAGGG - Exonic
1194282202 X:91966979-91967001 CCCACCCCCCACCCCCCGACTGG + Intronic
1194714597 X:97275323-97275345 CCCCCCGCCCACCTCCCTCCTGG + Intronic
1195625285 X:107000138-107000160 CCGGCCTCACCCCTCCCGCCCGG - Exonic
1196404266 X:115347267-115347289 CCCCCCCCCCACCTCCCTCCCGG + Intergenic
1196854524 X:119970373-119970395 CCCGCCCCCCGCCCCCCCCCCGG - Intergenic
1197754328 X:129983815-129983837 CCCTCCACCCGCTTCGCGCCAGG + Intronic
1198750403 X:139932487-139932509 ACCACCGCCCGCCTCCCCGCTGG + Intronic
1198833469 X:140776500-140776522 CCTTCCTCCCGCCACCCGCCGGG + Intergenic
1199172782 X:144750987-144751009 CCCACCTCACCCCTCCCAACAGG + Intergenic
1199976856 X:152899257-152899279 CCTGCCTCCCGCCCCCAGCCAGG - Intergenic
1199977319 X:152902037-152902059 CCCACCTCCCTGCTCCAGGCAGG - Intergenic
1200110599 X:153738865-153738887 CACACAGCCCGCCTCCAGCCTGG + Intronic
1200599793 Y:5191634-5191656 CCCACCCCCCACCCCCCGACTGG + Intronic