ID: 982712173

View in Genome Browser
Species Human (GRCh38)
Location 4:158768858-158768880
Sequence TAACCCCGGCGGGAGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712173_982712195 24 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712173_982712186 4 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712173_982712184 -6 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712173_982712185 -3 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712173_982712183 -7 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712183 4:158768874-158768896 GGGGTTACGTGAGCCCGGGGCGG No data
982712173_982712187 5 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712173_982712194 23 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712173_982712192 22 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712173_982712190 12 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712173_982712181 -10 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712173 Original CRISPR TAACCCCGGCGGGAGGCGGG AGG (reversed) Intergenic