ID: 982712174

View in Genome Browser
Species Human (GRCh38)
Location 4:158768861-158768883
Sequence ACGTAACCCCGGCGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712174_982712194 20 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712174_982712195 21 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712174_982712192 19 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712174_982712184 -9 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712174_982712183 -10 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712183 4:158768874-158768896 GGGGTTACGTGAGCCCGGGGCGG No data
982712174_982712187 2 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712174_982712190 9 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712174_982712185 -6 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712174_982712186 1 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712174 Original CRISPR ACGTAACCCCGGCGGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr