ID: 982712175

View in Genome Browser
Species Human (GRCh38)
Location 4:158768862-158768884
Sequence CACGTAACCCCGGCGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712175_982712195 20 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712175_982712187 1 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712175_982712194 19 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712175_982712184 -10 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712175_982712192 18 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712175_982712185 -7 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712175_982712190 8 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712175_982712186 0 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712175 Original CRISPR CACGTAACCCCGGCGGGAGG CGG (reversed) Intergenic