ID: 982712175

View in Genome Browser
Species Human (GRCh38)
Location 4:158768862-158768884
Sequence CACGTAACCCCGGCGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712175_982712187 1 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712175_982712195 20 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712175_982712190 8 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712175_982712185 -7 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712175_982712194 19 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712175_982712192 18 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712175_982712186 0 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712175_982712184 -10 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712175 Original CRISPR CACGTAACCCCGGCGGGAGG CGG (reversed) Intergenic
900435450 1:2628797-2628819 CACGGGACCACGGCGGGAAGGGG - Intronic
900516919 1:3086537-3086559 CAAGGCAGCCCGGCGGGAGGAGG - Intronic
906471211 1:46132711-46132733 CACCCAACCGCGCCGGGAGGGGG + Intronic
915325945 1:155081121-155081143 CACGTGACCCCCCCAGGAGGCGG - Intronic
916677323 1:167074983-167075005 CACTTGAACCTGGCGGGAGGAGG - Intronic
917310384 1:173671796-173671818 CACGTAAACCCGGGAGGCGGAGG + Intergenic
924436732 1:244049044-244049066 CCCGGCACCCCGGCGGGCGGGGG + Intronic
1063731079 10:8697913-8697935 CACTTAACCCCGGGAGGCGGAGG - Intergenic
1063981353 10:11454466-11454488 CATGTGACCCAGGAGGGAGGAGG - Intronic
1071699142 10:87910508-87910530 CACTTGAACCTGGCGGGAGGAGG - Intronic
1076386616 10:130061856-130061878 CAGGTAATCCCAGCAGGAGGCGG + Intergenic
1081536733 11:44002158-44002180 CACGTAACACAGGAGGAAGGAGG - Intergenic
1088239874 11:107762219-107762241 CACTTAAACCCGGGGGGTGGGGG + Intergenic
1092038685 12:5363989-5364011 CAGGTAACCTCAGCGGGAGCCGG + Intergenic
1108244722 13:48502973-48502995 CAGTTAAACCTGGCGGGAGGAGG - Intronic
1110212297 13:72987944-72987966 CACATAAACCCGGGGGGCGGAGG - Intronic
1115758005 14:36549113-36549135 CACAGAACCCCTGGGGGAGGTGG - Intergenic
1125633492 15:41167825-41167847 CACTTAACCCCAGAGGGTGGAGG + Intergenic
1126010181 15:44295161-44295183 CACTTCAGCCCGGCGGGTGGAGG - Intronic
1133950535 16:10387984-10388006 CACTTGAACCCGGAGGGAGGAGG - Intronic
1142018543 16:87765708-87765730 CCCGTAACCCCGGGGGGCGCAGG + Intronic
1142610970 17:1109109-1109131 CACGCAGCGGCGGCGGGAGGAGG + Intronic
1143061968 17:4209382-4209404 CACGTAAACCCGGGAGGCGGAGG - Intronic
1143100587 17:4502646-4502668 CACGCAACCCGGGAGGCAGGCGG - Intronic
1143104249 17:4520437-4520459 CTCGTCACCCCCCCGGGAGGGGG + Intronic
1145969998 17:28950999-28951021 CCCCCAACCCCGGGGGGAGGGGG + Exonic
1160947973 19:1652280-1652302 CAGGTGAGCCCGGCGGGGGGCGG - Exonic
1163622847 19:18371060-18371082 CACTTGAACCCGGCGGGTGGAGG + Intergenic
1163690116 19:18734016-18734038 CACTTGACCCCGGCAGGTGGAGG + Intronic
1164862197 19:31570541-31570563 CACATGCCCCTGGCGGGAGGTGG + Intergenic
1165956568 19:39505028-39505050 CATGTGACCCCAGAGGGAGGAGG - Intronic
1166708749 19:44923894-44923916 CGCTTAAACCCGGCGGGTGGAGG + Intergenic
932763876 2:74458104-74458126 CAGGTAATCCCGGCTGGAAGAGG - Intronic
1178202709 21:30425856-30425878 CAAGTAACCCCCGTGGGAGCAGG + Exonic
1180669275 22:17540698-17540720 CACACAGCCCCCGCGGGAGGTGG + Exonic
1181509327 22:23381984-23382006 CACGTGCCCCCGGCGGGGGATGG + Intergenic
1184222514 22:43110095-43110117 CCCGGAGCCCCGACGGGAGGGGG + Intergenic
956576402 3:70757278-70757300 CACGTCACCCAGGCGCAAGGAGG + Intergenic
968010505 3:195271130-195271152 CACTTAGCCCCGGCGCCAGGCGG + Exonic
968382699 4:109252-109274 CAGGGAACCCCTGGGGGAGGAGG - Intergenic
968456753 4:704295-704317 CACGTTATCCGGGTGGGAGGAGG - Intergenic
972393129 4:38631945-38631967 CACTTAAACCCGGGAGGAGGAGG + Intergenic
972621138 4:40749519-40749541 CACGTGAACCCGGGAGGAGGAGG + Intergenic
975156286 4:71076446-71076468 CACTTAAACCCGGGAGGAGGAGG + Intergenic
981881647 4:149620071-149620093 CACTTAAACCCGGCAGGTGGAGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
986170102 5:5308061-5308083 CATGCAACCCTGGCCGGAGGCGG - Intronic
1001862885 5:175074069-175074091 CACTTGAACCTGGCGGGAGGAGG + Intergenic
1011468969 6:87688664-87688686 CACTTGAACCCGGGGGGAGGTGG + Intronic
1015621851 6:135140054-135140076 CACTTAAACCCGGCAGGTGGAGG + Intergenic
1018324283 6:162648463-162648485 CACTTGAACCCGGCGGGCGGAGG - Intronic
1019301348 7:305645-305667 CACGGAACCACGGCAGGACGTGG + Intergenic
1047036951 8:120950601-120950623 CACTTAAACCCGGGAGGAGGAGG - Intergenic
1047737292 8:127777245-127777267 CACTTAAACCCGGTGGGTGGAGG - Intergenic
1051635403 9:19176857-19176879 CACTTAAACCCGGGGGGTGGAGG + Intergenic
1061451314 9:130668351-130668373 CCGGTAAACCCGGCGGGGGGAGG + Intronic
1185600392 X:1335193-1335215 CACTTAAACCCGGCAGGCGGAGG - Intergenic
1190277212 X:48906536-48906558 CACGTTACCTAGGTGGGAGGAGG + Exonic
1192429720 X:71103688-71103710 CACCTAACCCCTGCAGGAGTAGG + Intergenic
1200084807 X:153598942-153598964 CAGGTAACCGCGGCCGGGGGAGG - Exonic
1200323722 X:155216427-155216449 CACGGAATCCCGGCGGCCGGCGG + Exonic