ID: 982712176

View in Genome Browser
Species Human (GRCh38)
Location 4:158768865-158768887
Sequence GCTCACGTAACCCCGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712176_982712192 15 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712176_982712190 5 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC No data
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712176_982712186 -3 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712176_982712194 16 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC No data
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712176_982712195 17 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712176_982712187 -2 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712176_982712185 -10 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC No data
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712176 Original CRISPR GCTCACGTAACCCCGGCGGG AGG (reversed) Intergenic