ID: 982712176

View in Genome Browser
Species Human (GRCh38)
Location 4:158768865-158768887
Sequence GCTCACGTAACCCCGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712176_982712194 16 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712176_982712195 17 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712176_982712192 15 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712176_982712190 5 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712176_982712185 -10 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712185 4:158768878-158768900 TTACGTGAGCCCGGGGCGGGCGG No data
982712176_982712187 -2 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712176_982712186 -3 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712176 Original CRISPR GCTCACGTAACCCCGGCGGG AGG (reversed) Intergenic
903251237 1:22054300-22054322 GCTCACTTGACCCCGGGAGGCGG - Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG + Intronic
1125633491 15:41167822-41167844 GATCACTTAACCCCAGAGGGTGG + Intergenic
1130115205 15:81000622-81000644 GCTTACGTAAGGCCCGCGGGCGG + Intergenic
1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG + Intronic
1142179682 16:88662428-88662450 GGCCAGGTAACCCCGGCGCGAGG + Intronic
1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG + Exonic
1144840917 17:18185008-18185030 GCTCAGGTAACCCACCCGGGTGG + Exonic
1146844342 17:36173842-36173864 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146856647 17:36261777-36261799 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146863970 17:36326598-36326620 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1146872557 17:36385688-36385710 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1146879915 17:36436773-36436795 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147075441 17:37986312-37986334 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147078362 17:38006747-38006769 GCTCCCTTGACCCTGGCGGGGGG + Intronic
1147086966 17:38065858-38065880 GCTCCCTTGACCCTGGCGGGGGG - Intronic
1147094300 17:38130682-38130704 GCTCCCTTGACCCTGGCGGGGGG + Intergenic
1147102911 17:38189821-38189843 GCTCCCTTGACCCTGGCGGGGGG - Intergenic
1163012188 19:14433291-14433313 GGTCACGTGACCCCGGAGGTCGG - Intronic
1165113312 19:33514384-33514406 GCTCATGTGACCCTGGCAGGAGG - Intronic
934540963 2:95174654-95174676 GCTCACCTAACCCAGCAGGGAGG - Intronic
934567066 2:95346886-95346908 GCTCACATGCCCCCGGCAGGCGG - Intronic
1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG + Intergenic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
971030935 4:22635892-22635914 GCTCACCTGACCCCTGCTGGCGG - Intergenic
982695338 4:158592539-158592561 GCTCCCGTAGCCCAGGCTGGAGG - Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
992431457 5:76715352-76715374 GCGCAGGTGACCCCGGCGGGCGG + Intergenic
1015621850 6:135140051-135140073 GATCACTTAAACCCGGCAGGTGG + Intergenic
1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG + Intergenic
1018800919 6:167221744-167221766 GCTCACGTCACCCCCGTGGCTGG + Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1025231009 7:57203343-57203365 GCGCACGGAAGCCCGGCGGAGGG - Intergenic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1032174586 7:129612399-129612421 GCCCACGCCACCCCGGCAGGAGG - Intronic
1035171972 7:157021890-157021912 GCTCCCAAGACCCCGGCGGGAGG - Intergenic
1039896952 8:41723586-41723608 GATCACGTTGCCCCTGCGGGAGG + Exonic
1044734874 8:95269018-95269040 GCTCAGGTTAACCGGGCGGGAGG - Exonic
1060209165 9:121699645-121699667 ACTCACCTAACCCCGGAGGGAGG - Intronic
1186509090 X:10117198-10117220 GCTCAGGGAGCCCCGGCTGGAGG - Exonic
1187874212 X:23790297-23790319 GCTCACGTGAACCCGGGAGGTGG + Intergenic