ID: 982712178

View in Genome Browser
Species Human (GRCh38)
Location 4:158768869-158768891
Sequence CCGGGCTCACGTAACCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 32}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712178_982712194 12 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712178_982712190 1 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712178_982712195 13 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712178_982712192 11 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712178_982712186 -7 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712178_982712187 -6 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712178 Original CRISPR CCGGGCTCACGTAACCCCGG CGG (reversed) Intergenic
902640616 1:17764063-17764085 CAGGGCTCGGGAAACCCCGGTGG + Intronic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
1063608170 10:7541243-7541265 CTGGGCTCACGTCTCCCAGGAGG + Intergenic
1067469116 10:46523457-46523479 CCAGGCTCACAGAACCCCTGTGG + Intergenic
1076864058 10:133158853-133158875 CCGGGCTGACGTGACCCCAAAGG - Intergenic
1089537166 11:119168175-119168197 CTGGGCTCACGTAGCCCAGAAGG - Intronic
1113938735 13:114007822-114007844 CCGGGCTCAGGCAACACCTGGGG + Intronic
1122153950 14:99739237-99739259 CGGGGCTCCCGCAGCCCCGGCGG - Intronic
1122588535 14:102827992-102828014 CCGGGCTCAGGTACGCCCTGCGG - Intronic
1132286845 15:100669591-100669613 CAGGGCTCACTTTACCCAGGGGG - Intergenic
1135585774 16:23669770-23669792 CCAGGCTCAGGTACCCCCAGTGG - Exonic
1143879641 17:10020054-10020076 TCATGCTCACGCAACCCCGGAGG - Intronic
1144021331 17:11241608-11241630 CCGGGCGCCCGGAATCCCGGAGG + Exonic
1144855376 17:18264521-18264543 CCGGGGTCACCTGACCCAGGTGG + Exonic
1145065474 17:19758640-19758662 CTGGGCTCAAGCAACCCTGGTGG - Intergenic
1146224092 17:31050864-31050886 CAGGGCTCAGGTGACCCCAGGGG + Intergenic
1151405391 17:73882810-73882832 CCGTGCTCACGCACCCTCGGGGG + Intergenic
1152782055 17:82231019-82231041 CCGGGCTCCGCTGACCCCGGTGG + Intronic
1165412890 19:35673294-35673316 CCGGGCTCACGTAGTCACGGTGG - Exonic
929485058 2:42345764-42345786 CTGGGTTCACATGACCCCGGGGG - Intronic
935194211 2:100802389-100802411 CCAGGCTCACGAAAGCCCTGGGG - Intergenic
1182061929 22:27404631-27404653 CCTGGCTCACGTGACCCCCAGGG + Intergenic
950517898 3:13479628-13479650 CCTGGCTCAGCTTACCCCGGCGG + Intergenic
952929194 3:38346687-38346709 CCCGGCTCGCGTAGCCCCGCAGG + Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
997436067 5:133876570-133876592 CAAGGCTCACGTTACCCAGGTGG - Intergenic
1006828559 6:36954889-36954911 CCGGGCCCAGGTATCCCCGACGG + Exonic
1018800917 6:167221740-167221762 CCCGGCTCACGTCACCCCCGTGG + Intergenic
1020430333 7:8111497-8111519 CCGGGCTCATGCAAAGCCGGTGG - Intergenic
1021969328 7:25951305-25951327 CGGGGCGCACGTGACCCCGGGGG - Intergenic
1024803773 7:53111734-53111756 CCGGTCTCAGGTAGCCCAGGTGG - Intergenic
1036466529 8:9002943-9002965 CCGGGCTCGCGTTCCCGCGGCGG - Exonic
1039936790 8:42052214-42052236 CCGGCCCCACGTGACCCCGCCGG - Intergenic
1040626570 8:49156633-49156655 CGGGGCTCATGTAACCATGGGGG - Intergenic
1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG + Exonic
1198205415 X:134460437-134460459 CCGGGCCCAGGGAACCCCGCAGG + Intronic
1199608147 X:149592936-149592958 CCAGGCTCACGTCACTCCGGTGG - Exonic
1199630973 X:149776424-149776446 CCAGGCTCACGTCACTCCGGTGG + Exonic