ID: 982712178

View in Genome Browser
Species Human (GRCh38)
Location 4:158768869-158768891
Sequence CCGGGCTCACGTAACCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712178_982712187 -6 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712178_982712194 12 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712178_982712190 1 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data
982712178_982712192 11 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712178_982712195 13 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712178_982712186 -7 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712178 Original CRISPR CCGGGCTCACGTAACCCCGG CGG (reversed) Intergenic