ID: 982712179

View in Genome Browser
Species Human (GRCh38)
Location 4:158768869-158768891
Sequence CCGCCGGGGTTACGTGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 30}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712171_982712179 -9 Left 982712171 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712164_982712179 10 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712160_982712179 18 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712162_982712179 14 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712166_982712179 0 Left 982712166 4:158768846-158768868 CCGCACCTCCCACCTCCCGCCTC No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712165_982712179 5 Left 982712165 4:158768841-158768863 CCTGGCCGCACCTCCCACCTCCC No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712167_982712179 -5 Left 982712167 4:158768851-158768873 CCTCCCACCTCCCGCCTCCCGCC No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712161_982712179 15 Left 982712161 4:158768831-158768853 CCCGCCCGCTCCTGGCCGCACCT No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712163_982712179 11 Left 982712163 4:158768835-158768857 CCCGCTCCTGGCCGCACCTCCCA No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30
982712169_982712179 -8 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712179 Original CRISPR CCGCCGGGGTTACGTGAGCC CGG Intergenic
1067469115 10:46523457-46523479 CCACAGGGGTTCTGTGAGCCTGG - Intergenic
1076837897 10:133030252-133030274 GCGCCGGGGTCCCGTGTGCCGGG + Intergenic
1077051552 11:568959-568981 CGGCCCGGGATACGTGCGCCGGG - Intergenic
1079056153 11:17208083-17208105 CTGCCGGGGTGGCGTGAGCAAGG + Intergenic
1083876199 11:65525445-65525467 GGGCCGGGGTCACGTGGGCCCGG + Intronic
1121915112 14:97831627-97831649 ACGCCAGGGTTAAATGAGCCAGG + Intergenic
1122588536 14:102827992-102828014 CCGCAGGGCGTACCTGAGCCCGG + Intronic
1122700178 14:103582913-103582935 CTGCCGGGGTTAGGTGAGGCAGG - Intronic
1135585775 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG + Exonic
1162016030 19:7846918-7846940 CCGCCGCGGTTAATGGAGCCAGG + Intronic
1163765367 19:19160715-19160737 CAGCCTGGGTTGCGTGAGGCGGG - Intronic
1165412891 19:35673294-35673316 CCACCGTGACTACGTGAGCCCGG + Exonic
1166294257 19:41881232-41881254 CCGCTGGGGTGAGGGGAGCCTGG - Exonic
935194212 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG + Intergenic
1182061928 22:27404631-27404653 CCCTGGGGGTCACGTGAGCCAGG - Intergenic
1183490052 22:38111276-38111298 CTGCCGGGGGTATGTGGGCCTGG + Intergenic
950517897 3:13479628-13479650 CCGCCGGGGTAAGCTGAGCCAGG - Intergenic
952929193 3:38346687-38346709 CCTGCGGGGCTACGCGAGCCGGG - Intergenic
981494414 4:145375527-145375549 CCGCCATGGCTACGTGAGCGAGG - Intergenic
982712179 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG + Intergenic
983254291 4:165379859-165379881 CCGCTGGGGTTGCGTGCGTCAGG - Intronic
984473629 4:180210114-180210136 ACTCCGGGGTTCCTTGAGCCTGG - Intergenic
990699430 5:58459797-58459819 CCGCCGGGGGCACTTGCGCCTGG + Exonic
1006828558 6:36954889-36954911 CCGTCGGGGATACCTGGGCCCGG - Exonic
1018800916 6:167221740-167221762 CCACGGGGGTGACGTGAGCCGGG - Intergenic
1019301346 7:305638-305660 CTGCCGTGGTTCCGTGAGCGCGG - Intergenic
1026048036 7:66921449-66921471 CCGCCGGGGCGGGGTGAGCCGGG + Exonic
1036466530 8:9002943-9002965 CCGCCGCGGGAACGCGAGCCCGG + Exonic
1039936791 8:42052214-42052236 CCGGCGGGGTCACGTGGGGCCGG + Intergenic
1049408998 8:142464162-142464184 CCGCCGGGGTTCCGCGGGCTGGG - Exonic
1053110486 9:35455581-35455603 CAGCAGGGGCCACGTGAGCCAGG - Intergenic
1058176001 9:101737636-101737658 TCCCCGGGCTTACGGGAGCCCGG + Exonic
1058176004 9:101737639-101737661 CCGCCGGGCTCCCGTAAGCCCGG - Exonic
1194764885 X:97838183-97838205 CAGCCTGGGTGACGTGAGGCAGG - Intergenic
1199608148 X:149592936-149592958 CCACCGGAGTGACGTGAGCCTGG + Exonic
1199630972 X:149776424-149776446 CCACCGGAGTGACGTGAGCCTGG - Exonic