ID: 982712181

View in Genome Browser
Species Human (GRCh38)
Location 4:158768871-158768893
Sequence GCCGGGGTTACGTGAGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712167_982712181 -3 Left 982712167 4:158768851-158768873 CCTCCCACCTCCCGCCTCCCGCC No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712169_982712181 -6 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712166_982712181 2 Left 982712166 4:158768846-158768868 CCGCACCTCCCACCTCCCGCCTC No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712173_982712181 -10 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712163_982712181 13 Left 982712163 4:158768835-158768857 CCCGCTCCTGGCCGCACCTCCCA No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712161_982712181 17 Left 982712161 4:158768831-158768853 CCCGCCCGCTCCTGGCCGCACCT No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712162_982712181 16 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712160_982712181 20 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712164_982712181 12 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712165_982712181 7 Left 982712165 4:158768841-158768863 CCTGGCCGCACCTCCCACCTCCC No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data
982712171_982712181 -7 Left 982712171 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
Right 982712181 4:158768871-158768893 GCCGGGGTTACGTGAGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712181 Original CRISPR GCCGGGGTTACGTGAGCCCG GGG Intergenic
No off target data available for this crispr