ID: 982712182

View in Genome Browser
Species Human (GRCh38)
Location 4:158768872-158768894
Sequence GCCCCGGGCTCACGTAACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712182_982712186 -10 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG No data
982712182_982712194 9 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712194 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
982712182_982712195 10 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712182_982712187 -9 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712182_982712192 8 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712182_982712190 -2 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712190 4:158768893-158768915 GCGGGCGGCCGCCGGGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712182 Original CRISPR GCCCCGGGCTCACGTAACCC CGG (reversed) Intergenic
No off target data available for this crispr