ID: 982712184

View in Genome Browser
Species Human (GRCh38)
Location 4:158768875-158768897
Sequence GGGTTACGTGAGCCCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712164_982712184 16 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712160_982712184 24 Left 982712160 4:158768828-158768850 CCGCCCGCCCGCTCCTGGCCGCA 0: 1
1: 0
2: 0
3: 35
4: 365
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712175_982712184 -10 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712174_982712184 -9 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712165_982712184 11 Left 982712165 4:158768841-158768863 CCTGGCCGCACCTCCCACCTCCC No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712166_982712184 6 Left 982712166 4:158768846-158768868 CCGCACCTCCCACCTCCCGCCTC No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712162_982712184 20 Left 982712162 4:158768832-158768854 CCGCCCGCTCCTGGCCGCACCTC 0: 1
1: 0
2: 2
3: 34
4: 393
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712167_982712184 1 Left 982712167 4:158768851-158768873 CCTCCCACCTCCCGCCTCCCGCC No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712161_982712184 21 Left 982712161 4:158768831-158768853 CCCGCCCGCTCCTGGCCGCACCT No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712171_982712184 -3 Left 982712171 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712163_982712184 17 Left 982712163 4:158768835-158768857 CCCGCTCCTGGCCGCACCTCCCA No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712169_982712184 -2 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data
982712173_982712184 -6 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712184 4:158768875-158768897 GGGTTACGTGAGCCCGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712184 Original CRISPR GGGTTACGTGAGCCCGGGGC GGG Intergenic
No off target data available for this crispr