ID: 982712187

View in Genome Browser
Species Human (GRCh38)
Location 4:158768886-158768908
Sequence GCCCGGGGCGGGCGGCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712173_982712187 5 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712176_982712187 -2 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712182_982712187 -9 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712164_982712187 27 Left 982712164 4:158768836-158768858 CCGCTCCTGGCCGCACCTCCCAC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712163_982712187 28 Left 982712163 4:158768835-158768857 CCCGCTCCTGGCCGCACCTCCCA No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712174_982712187 2 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712167_982712187 12 Left 982712167 4:158768851-158768873 CCTCCCACCTCCCGCCTCCCGCC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712178_982712187 -6 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712165_982712187 22 Left 982712165 4:158768841-158768863 CCTGGCCGCACCTCCCACCTCCC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712171_982712187 8 Left 982712171 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712175_982712187 1 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712166_982712187 17 Left 982712166 4:158768846-158768868 CCGCACCTCCCACCTCCCGCCTC No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712177_982712187 -5 Left 982712177 4:158768868-158768890 CCCGCCGGGGTTACGTGAGCCCG No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data
982712169_982712187 9 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712187 Original CRISPR GCCCGGGGCGGGCGGCCGCC GGG Intergenic
No off target data available for this crispr