ID: 982712192

View in Genome Browser
Species Human (GRCh38)
Location 4:158768903-158768925
Sequence GCCGGGCCAATGGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712173_982712192 22 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712188_982712192 -7 Left 982712188 4:158768887-158768909 CCCGGGGCGGGCGGCCGCCGGGC 0: 1
1: 0
2: 4
3: 79
4: 832
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712171_982712192 25 Left 982712171 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712189_982712192 -8 Left 982712189 4:158768888-158768910 CCGGGGCGGGCGGCCGCCGGGCC No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712176_982712192 15 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712177_982712192 12 Left 982712177 4:158768868-158768890 CCCGCCGGGGTTACGTGAGCCCG No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712167_982712192 29 Left 982712167 4:158768851-158768873 CCTCCCACCTCCCGCCTCCCGCC No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712178_982712192 11 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712169_982712192 26 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712175_982712192 18 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712182_982712192 8 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data
982712174_982712192 19 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712192 4:158768903-158768925 GCCGGGCCAATGGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712192 Original CRISPR GCCGGGCCAATGGCCGCCGC CGG Intergenic
No off target data available for this crispr