ID: 982712195

View in Genome Browser
Species Human (GRCh38)
Location 4:158768905-158768927
Sequence CGGGCCAATGGCCGCCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712173_982712195 24 Left 982712173 4:158768858-158768880 CCTCCCGCCTCCCGCCGGGGTTA No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712175_982712195 20 Left 982712175 4:158768862-158768884 CCGCCTCCCGCCGGGGTTACGTG 0: 1
1: 0
2: 0
3: 0
4: 61
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712188_982712195 -5 Left 982712188 4:158768887-158768909 CCCGGGGCGGGCGGCCGCCGGGC 0: 1
1: 0
2: 4
3: 79
4: 832
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712178_982712195 13 Left 982712178 4:158768869-158768891 CCGCCGGGGTTACGTGAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712177_982712195 14 Left 982712177 4:158768868-158768890 CCCGCCGGGGTTACGTGAGCCCG No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712174_982712195 21 Left 982712174 4:158768861-158768883 CCCGCCTCCCGCCGGGGTTACGT No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712176_982712195 17 Left 982712176 4:158768865-158768887 CCTCCCGCCGGGGTTACGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712189_982712195 -6 Left 982712189 4:158768888-158768910 CCGGGGCGGGCGGCCGCCGGGCC No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712182_982712195 10 Left 982712182 4:158768872-158768894 CCGGGGTTACGTGAGCCCGGGGC No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712171_982712195 27 Left 982712171 4:158768855-158768877 CCACCTCCCGCCTCCCGCCGGGG No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data
982712169_982712195 28 Left 982712169 4:158768854-158768876 CCCACCTCCCGCCTCCCGCCGGG No data
Right 982712195 4:158768905-158768927 CGGGCCAATGGCCGCCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712195 Original CRISPR CGGGCCAATGGCCGCCGCCG GGG Intergenic
No off target data available for this crispr