ID: 982712211

View in Genome Browser
Species Human (GRCh38)
Location 4:158768951-158768973
Sequence CGCCGCCGCCGTGGGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 292}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982712196_982712211 19 Left 982712196 4:158768909-158768931 CCAATGGCCGCCGCCGGGGCCGC No data
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712201_982712211 -3 Left 982712201 4:158768931-158768953 CCGCGCTCCTCCCGCGCCGCCGC 0: 1
1: 1
2: 13
3: 110
4: 841
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712193_982712211 24 Left 982712193 4:158768904-158768926 CCGGGCCAATGGCCGCCGCCGGG No data
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712202_982712211 -10 Left 982712202 4:158768938-158768960 CCTCCCGCGCCGCCGCCGCCGCC 0: 19
1: 87
2: 1388
3: 2375
4: 5107
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712191_982712211 27 Left 982712191 4:158768901-158768923 CCGCCGGGCCAATGGCCGCCGCC No data
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712198_982712211 9 Left 982712198 4:158768919-158768941 CCGCCGGGGCCGCCGCGCTCCTC 0: 1
1: 1
2: 11
3: 60
4: 379
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712197_982712211 12 Left 982712197 4:158768916-158768938 CCGCCGCCGGGGCCGCCGCGCTC 0: 1
1: 0
2: 22
3: 148
4: 831
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712200_982712211 0 Left 982712200 4:158768928-158768950 CCGCCGCGCTCCTCCCGCGCCGC 0: 1
1: 0
2: 5
3: 78
4: 592
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292
982712199_982712211 6 Left 982712199 4:158768922-158768944 CCGGGGCCGCCGCGCTCCTCCCG 0: 1
1: 1
2: 7
3: 65
4: 521
Right 982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG 0: 1
1: 0
2: 2
3: 42
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982712211 Original CRISPR CGCCGCCGCCGTGGGGCTGC GGG Intergenic
900330543 1:2132376-2132398 CGGAGCAGCAGTGGGGCTGCCGG + Intronic
901057528 1:6455588-6455610 CGCCGCCGTCCAGGGGCGGCAGG - Intronic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
901443311 1:9292644-9292666 AGCCGCCGCCCTGGTGTTGCCGG - Intergenic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902531721 1:17094814-17094836 AGCTGTCGCCCTGGGGCTGCTGG + Intronic
903750175 1:25616684-25616706 CGCCGCCGCCGCGCCGCAGCCGG - Intergenic
903879647 1:26500344-26500366 CGCCGCCACCGTGTGGCCGAAGG - Intergenic
904199863 1:28812557-28812579 CGTGTGCGCCGTGGGGCTGCTGG + Exonic
904775134 1:32901554-32901576 CGCCGCCGCCGGTGGGCTGAGGG - Intergenic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
905995787 1:42380222-42380244 CCCCACCCCCGTGGGGCTTCAGG + Intergenic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
913069583 1:115286622-115286644 CGCCGCTGCCGGGGCGCTGCGGG + Exonic
915213402 1:154325769-154325791 GGCCGCAGCCGCGGGGCTGGAGG + Intronic
916548390 1:165827869-165827891 GCTCGCCGCCGTTGGGCTGCTGG - Exonic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
919724515 1:200873181-200873203 GGCCTTCGCCGTGGGCCTGCTGG + Exonic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922456509 1:225777825-225777847 CGCCGCCATCTTGGGGCTGCTGG + Exonic
1062898100 10:1120364-1120386 CGCCGCCTCCGAGGGGCACCCGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064443167 10:15371233-15371255 CGCCGCCGCCGCGGCTCTTCGGG - Intergenic
1065100515 10:22326106-22326128 TGCAGCAGCCTTGGGGCTGCTGG + Intronic
1067436931 10:46284901-46284923 CGCCGCCGCCCTCTGGCTCCTGG + Intergenic
1067560379 10:47300783-47300805 CGCGGCCGCCGACGGCCTGCAGG + Exonic
1068455605 10:57250256-57250278 GGATGCCGCCCTGGGGCTGCAGG - Intergenic
1068669565 10:59709700-59709722 CGCCGCCGCTGCGGGTCTGTGGG - Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1072891540 10:99329495-99329517 GGCCGCCGCCGCCTGGCTGCTGG + Exonic
1073531066 10:104232312-104232334 TTCCGCCGCCGCGGGGCTGCGGG + Exonic
1074121737 10:110498367-110498389 CGTCGCGGCCGTGGTGGTGCTGG + Exonic
1074586047 10:114768353-114768375 CGCCGCGGCAGAGCGGCTGCTGG - Intergenic
1074866126 10:117545338-117545360 CGCAGCCGCCCTGGCGCCGCGGG - Intronic
1076348752 10:129800136-129800158 TGGAGCAGCCGTGGGGCTGCAGG - Intergenic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1076472207 10:130727165-130727187 GGGCGCCTCCGTGGGGCGGCTGG + Intergenic
1076919250 10:133442753-133442775 CTCTGCTGCCGTGGGGCTGTGGG + Intergenic
1076992102 11:280718-280740 CGCCGCCCCCGGGAGGCTGCAGG + Exonic
1077356666 11:2121941-2121963 CACCGCCACTCTGGGGCTGCAGG + Intergenic
1078139854 11:8684013-8684035 CGCGGCCGCCGGGGTGCTTCCGG - Exonic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079126237 11:17720328-17720350 CGCCGCGGCCCGGGGGCAGCGGG - Exonic
1079451177 11:20601166-20601188 CGCCGCCGCCTCCGGGCTGTTGG - Exonic
1081636757 11:44726968-44726990 CGCCGGCGTCGCGGGGCTCCAGG + Intronic
1081636901 11:44727361-44727383 CGCCGCCCCGGGGGTGCTGCTGG + Intronic
1081811064 11:45914361-45914383 CCCCACCCCCCTGGGGCTGCAGG - Exonic
1081845493 11:46238022-46238044 CGCCGACGCCGCATGGCTGCCGG + Intergenic
1082175217 11:49050147-49050169 CGCCTCCGGCATGGTGCTGCTGG - Intergenic
1082783265 11:57302735-57302757 AGCCACCGCCTTGGAGCTGCTGG + Exonic
1083265762 11:61546206-61546228 GGCCGCCGCGGCGGGGCTGGCGG - Exonic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1083662544 11:64258462-64258484 CGCCGCCCCAGCGGGGCAGCTGG + Exonic
1083759887 11:64810097-64810119 GCCCGCCGCCATGGGGCTGAAGG - Exonic
1084946902 11:72643202-72643224 CGCCGCCGCGATGGGACGGCAGG - Intronic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1086690547 11:89785936-89785958 CGCCTCCGGCATGGTGCTGCTGG + Intergenic
1086697981 11:89865585-89865607 GGCCGCCGGCGTGGTGCTGCTGG - Intergenic
1086708181 11:89978903-89978925 GGCCGCCGGCGTGGTGCTGCTGG + Intergenic
1086715251 11:90053723-90053745 CGCCTCCGGCATGGTGCTGCTGG - Intergenic
1088920723 11:114258205-114258227 GGATGCCGCCGTGGGGCTGCAGG + Intronic
1090658894 11:128866931-128866953 CTCCGCAGCCCTGGGGCTGGAGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091759604 12:3077869-3077891 CGCGGGTGCCGGGGGGCTGCAGG - Intronic
1092258088 12:6937769-6937791 CGCCGGGGCCGCGGCGCTGCGGG + Intronic
1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG + Intronic
1095271509 12:40224803-40224825 GGCGGCGGCCGTGGGGCTGCTGG - Intronic
1095476178 12:42589502-42589524 CGGCGCCGCTGCGGGGCTGCTGG + Exonic
1095964342 12:47857052-47857074 CGCACCTGCCCTGGGGCTGCTGG - Intronic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1096622684 12:52874327-52874349 CGGCGCCGCCCTGGGGCCCCCGG - Intergenic
1096782728 12:54000431-54000453 CGGCGCCGAGGTGGGGCTGGGGG - Exonic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097895946 12:64824927-64824949 CGCCGCCGCCCTGCCGCTTCAGG - Exonic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1101606116 12:106248311-106248333 CGCGGCCGAGGTGGGGCTGGCGG + Intronic
1102101277 12:110281016-110281038 CGCCGCGGTCGCGGGGCTGGCGG - Intronic
1103407773 12:120687581-120687603 CGCAGCCGGCCGGGGGCTGCGGG + Intronic
1103701201 12:122849527-122849549 CGCAGGGGCCGTGGGGCTGGAGG + Intronic
1108555268 13:51584986-51585008 CGCCTCCGCTGTGTGGCTCCGGG + Intronic
1110887260 13:80655168-80655190 TGCCGCCCCCGCCGGGCTGCGGG - Intergenic
1112291023 13:98143749-98143771 CTCCGCCGACGTCGGGCTGCGGG + Intronic
1113603289 13:111586525-111586547 CGCCGATGCCCTGGGGATGCCGG + Intergenic
1118748345 14:68789889-68789911 CGCCGCTGCCACCGGGCTGCTGG - Exonic
1121042223 14:90758587-90758609 GGCGGCTGCCGAGGGGCTGCGGG + Intronic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1122082277 14:99274257-99274279 CGCCGGCGGCGCTGGGCTGCAGG - Intergenic
1122232357 14:100313092-100313114 GGCCCCCGCAGTGGGGCTCCCGG + Intergenic
1122399144 14:101457395-101457417 AGCTGCCGCCGTGGGGCGGGGGG + Intergenic
1122671047 14:103372689-103372711 CGCCTTCCCCGTGGGGCTGCTGG - Intergenic
1122723009 14:103732541-103732563 GGCCACCGCCTTGGGGCTGGTGG + Intronic
1123036032 14:105472334-105472356 CGCGGCCCCTGTGGGGTTGCTGG - Intergenic
1124713040 15:32030751-32030773 CGCCGCCGGGGAGGGGCAGCGGG + Intronic
1127084085 15:55408451-55408473 GGCCGCCGCCGGGCGGCTGCGGG + Intronic
1127515457 15:59689177-59689199 GGCCGGCGACGTGGGGCTGACGG + Exonic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1128743574 15:70098916-70098938 CGCCAACGCCGTGGCACTGCCGG - Intergenic
1129391642 15:75223831-75223853 CCCCCCTGCAGTGGGGCTGCAGG + Intergenic
1129424659 15:75454792-75454814 CGCCGCCGCCTTGGGGTGGGCGG + Intronic
1129472657 15:75764023-75764045 CCCCCCTGCAGTGGGGCTGCAGG - Intergenic
1129644737 15:77419832-77419854 CGCCGCCGCCGGGGCTCTGGCGG - Intronic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130115246 15:81000752-81000774 CGCTGCCGGCGTGGGGCCGGTGG - Intergenic
1130224246 15:82045660-82045682 CGCCGCTGCCGTTGCGCTCCAGG + Exonic
1130224557 15:82046987-82047009 CGCCGCCACCGCGGGGACGCAGG + Intergenic
1130348142 15:83067361-83067383 CGCCCCTGCCCTGGGGCTGCCGG - Intergenic
1132111569 15:99105580-99105602 CGCCGCCCTCGAGGCGCTGCTGG + Exonic
1132178281 15:99732928-99732950 GGCTGCCGCCGTGGTCCTGCAGG - Exonic
1132588410 16:715956-715978 CGCCGAGACCGTGGGCCTGCGGG - Exonic
1132636356 16:951725-951747 CGCCGCCTCTGGGGGTCTGCAGG - Intronic
1132931221 16:2460132-2460154 CGCCGCCGCCTTCATGCTGCCGG + Exonic
1132934695 16:2474573-2474595 CGCCGCCCTCGTGGGGCTGCAGG - Intergenic
1133022252 16:2971879-2971901 CGACGCCGGCGTGCAGCTGCAGG - Exonic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133270736 16:4609780-4609802 CGAGGCCGCCGTGGGCCAGCTGG + Exonic
1133924761 16:10183299-10183321 CGTCGCCGCCGAGGGACTGCGGG - Intergenic
1134718009 16:16366540-16366562 CGCCGTGGCCGCGGGGCTGTTGG + Intergenic
1134956742 16:18385619-18385641 CGCCGTGGCCGCGGGGCTGTTGG - Intergenic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1137731430 16:50693459-50693481 AGCCGGCGCTGCGGGGCTGCGGG + Intergenic
1137988486 16:53130532-53130554 GGCGGCCGCGGCGGGGCTGCCGG + Intronic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1140209531 16:72959680-72959702 CGCCCCCGCCCTGGGTCAGCTGG + Exonic
1141989684 16:87602773-87602795 CGCCCTCCCCGCGGGGCTGCCGG + Intronic
1143527265 17:7479699-7479721 CGCCGCCGCCGAGAGGAGGCCGG + Intronic
1143783249 17:9240282-9240304 CGCGGCCGCCGTGGAGGGGCTGG + Exonic
1144737671 17:17564087-17564109 TGCCTCCGCCCTGGGGCTGGTGG - Intronic
1144758705 17:17695045-17695067 GGCCCCTGCCGTGGGGTTGCCGG - Intronic
1144784430 17:17823818-17823840 CCCCGCCGCCGTGGGGAGGTGGG - Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1147141950 17:38465125-38465147 TGCCGCCGCCGTGATGATGCCGG + Intronic
1147686194 17:42288249-42288271 AGCCGCCGCCGAGGGCCTGCTGG + Exonic
1148397733 17:47323819-47323841 CGCCACCGCCCAGGGGCTCCGGG - Intronic
1149270095 17:54968325-54968347 CGCTGTCGCCGTGGGCATGCTGG - Exonic
1149621256 17:58046978-58047000 CGCCACCGCCTTCAGGCTGCGGG - Intergenic
1150228726 17:63538357-63538379 CGCGGCCGGGGTGGGGCTGGGGG - Intronic
1152237896 17:79147998-79148020 CGCCGCTGCCGTGGGGCCCCGGG + Intronic
1154132897 18:11751660-11751682 CGGCGCAGCGGAGGGGCTGCGGG + Intronic
1155300801 18:24426975-24426997 CGCGGCCGCCGAGGAGCCGCCGG - Intronic
1157544515 18:48538809-48538831 CGCCAGCGCCGTGGGGTCGCTGG + Intergenic
1158938359 18:62384959-62384981 CGGCGGCCCCGAGGGGCTGCGGG + Exonic
1159617939 18:70603191-70603213 CCCCGACCCTGTGGGGCTGCTGG - Intergenic
1160025341 18:75211498-75211520 CCCCGCCGCCGCGCTGCTGCTGG - Intronic
1160521079 18:79508355-79508377 CGCCGCTGCCCTGTGGCTGCTGG - Intronic
1160856776 19:1221361-1221383 CCCCGCCTCCCTGGGGCTGCGGG - Intronic
1160927887 19:1555803-1555825 GGCGGCGGCCGCGGGGCTGCTGG + Exonic
1160960609 19:1719051-1719073 CGCCGCCGCAGCGGGGCTGGGGG + Intergenic
1161115564 19:2494870-2494892 GCCCGCCGCCGTGGGTCTTCCGG - Intergenic
1161504975 19:4639206-4639228 CGAGGCCGTCGTGGGGGTGCCGG - Intergenic
1162555121 19:11381820-11381842 AGACGCCCCCGTGGGGCTGGTGG - Exonic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1163666851 19:18607321-18607343 CGCCGAGGGCGTGGGGCTGGGGG - Intronic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167331921 19:48861414-48861436 CGCCGCCCTCGGGGGGCTCCCGG + Exonic
1167380330 19:49134576-49134598 GGCCACGCCCGTGGGGCTGCAGG - Intronic
1167492837 19:49801998-49802020 CGCCGACCTCCTGGGGCTGCGGG + Exonic
1167535830 19:50050789-50050811 CGCCACCAACGTGGGGATGCTGG - Intronic
1167557171 19:50203686-50203708 CGCCGCCCCCGGAGGGCTGCCGG - Intronic
1168123915 19:54272396-54272418 TGCCAGCGCCGAGGGGCTGCTGG + Intronic
1168294967 19:55373838-55373860 CGTCCCCGCAGTGTGGCTGCAGG + Intergenic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
924962166 2:45569-45591 CGGCGACGACGAGGGGCTGCAGG - Exonic
927904286 2:26846531-26846553 CCCCGCCGCCGGGAGGCCGCTGG + Intergenic
928549511 2:32357277-32357299 CCCCGCCGCCGAGGAGCAGCCGG - Exonic
928927947 2:36597798-36597820 AGCTGCGGCCGTAGGGCTGCCGG + Intronic
932567690 2:72919985-72920007 CGCCGCGGCCGAGGGGCTGGCGG + Intronic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935786360 2:106552285-106552307 CGAAGCCGCCTTGGGGCTGATGG - Intergenic
936452842 2:112646181-112646203 CGCGGACGCCGTGGCGCTGGAGG + Intronic
937325813 2:120989061-120989083 CGAGGCCGACCTGGGGCTGCCGG + Exonic
938315931 2:130327967-130327989 CGCCGCCGTCGGGCGCCTGCTGG + Intergenic
938397854 2:130963965-130963987 TGCGGCGGCCGCGGGGCTGCCGG - Intronic
938540640 2:132281220-132281242 CGTAGACTCCGTGGGGCTGCAGG + Intergenic
939004105 2:136765877-136765899 CGCCTCTGGCTTGGGGCTGCGGG + Intronic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
940962081 2:159797704-159797726 CGCGGCCGGAGTGGGGTTGCTGG - Intronic
942046557 2:172102439-172102461 CGCCGCCGCTCGGGGGCTGCTGG + Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944412854 2:199459335-199459357 CGCGGCCGGAGTCGGGCTGCCGG - Intronic
946161029 2:217836157-217836179 CGCCTCCGCAGAGGGGCTGGGGG + Exonic
946322083 2:218960144-218960166 CGCCGCCGTCGGGGGGATCCCGG - Exonic
946339905 2:219060381-219060403 TGCCGGCGGCATGGGGCTGCGGG - Exonic
946966580 2:225042779-225042801 GGCGGCCGCCGAGGGGCTCCGGG + Intergenic
947418566 2:229921951-229921973 CGCCGCCGCCGCGCCGCTGGGGG - Exonic
947860514 2:233354511-233354533 CGCCGCCGCCGCCATGCTGCCGG - Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948207254 2:236168698-236168720 CGGCCCAGCCGTGGGGGTGCGGG - Intergenic
948479153 2:238239626-238239648 GGCAGGCGCCGTGGGGCTGCGGG - Intronic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1171123705 20:22584891-22584913 CGCCGCGGCGGTGGGGCGGACGG - Intronic
1171455807 20:25271577-25271599 CGCCCCCGCCAGGGGACTGCAGG + Intronic
1171499834 20:25585180-25585202 CGCCGCCGCCGTCGGGAAACCGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1172882977 20:38213584-38213606 GCTCGCAGCCGTGGGGCTGCAGG - Exonic
1174246812 20:49188049-49188071 CGCCGCCGCGGTGGGGAGGTGGG - Intronic
1176095707 20:63343489-63343511 CGCAGCTGCTGTGGGACTGCTGG - Intronic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1178263429 21:31120709-31120731 CCCCACCACCGGGGGGCTGCTGG + Exonic
1180042235 21:45286877-45286899 CGCGGCCGCCCTGTGGCTGTGGG - Intronic
1180991856 22:19941798-19941820 CGCCATCGTCGTGGGGCTTCTGG + Exonic
1182729394 22:32474993-32475015 TGCCGCCGTCATGAGGCTGCGGG + Exonic
1183683765 22:39350200-39350222 CGCCGCCGCCGGGGGCCCGTTGG - Intronic
1183720324 22:39558395-39558417 CGCAGCCGCGGAGGGGCGGCCGG - Intergenic
1183939526 22:41285578-41285600 CCCCGCGGGCGTGGGCCTGCTGG + Intronic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185292016 22:50031976-50031998 CGCCACGGCCCTGGCGCTGCAGG + Exonic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
950530155 3:13548673-13548695 TGCAGCAGCAGTGGGGCTGCAGG + Intergenic
950903002 3:16513716-16513738 CGCCGCCGCCGCGCGTCCGCCGG + Intronic
951543625 3:23806110-23806132 CGGCGCGGCCGGGGGGCGGCGGG - Intronic
952436526 3:33277462-33277484 CGCCGGCGCCGTGTGACTTCGGG + Exonic
953027563 3:39153689-39153711 CGCCTCCGGGGCGGGGCTGCCGG - Intronic
954779105 3:53046151-53046173 CGCCGCGCCCGTGGAGCTCCCGG + Intronic
961536682 3:127575146-127575168 CGGCGCCCCCGCGTGGCTGCCGG - Intronic
962583541 3:136819226-136819248 CGCCGCCGCCGACCGGCTCCCGG - Exonic
963713660 3:148777395-148777417 CTCCGCAGCCTTGGGGCTACTGG + Intergenic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
966696330 3:182793705-182793727 CGCGGGGGCCGCGGGGCTGCAGG - Exonic
968453069 4:684163-684185 CCCCGCCCCTGTGGGTCTGCAGG - Intronic
968509610 4:989663-989685 CAGCGCCACCGTGGTGCTGCTGG - Exonic
968592037 4:1464147-1464169 TGCTGACGCTGTGGGGCTGCCGG - Intergenic
968701305 4:2059409-2059431 CGCCGCCGCCGCGGGTCCGAGGG + Intergenic
968708035 4:2092532-2092554 CGCAGCCACCGTGGGGGAGCTGG - Intronic
969379154 4:6782920-6782942 GCTCGCCGCCGTGGGGCTCCGGG + Intronic
969392764 4:6902058-6902080 ACAGGCCGCCGTGGGGCTGCGGG + Intergenic
969540851 4:7787978-7788000 AGGGGCCGCTGTGGGGCTGCGGG - Intronic
969688584 4:8690710-8690732 TGCCACGGCCGTGTGGCTGCAGG + Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970332935 4:15003478-15003500 TGGCGGCGCCGCGGGGCTGCAGG - Exonic
970456168 4:16226376-16226398 CGCCGCGGCCGTCCCGCTGCGGG + Exonic
970589769 4:17549301-17549323 CTCAGCGGGCGTGGGGCTGCCGG + Intergenic
972265346 4:37454019-37454041 CGCCGCCGCCGTCTGGCCCCAGG + Intronic
974716016 4:65669688-65669710 CGCCGCCGCTTGGGGGCCGCCGG + Exonic
980541441 4:134201532-134201554 CGCCGCCGCCGAGGCGCTGCCGG + Intronic
981782376 4:148443714-148443736 AGCTGCCGCCGCCGGGCTGCGGG - Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983904753 4:173170237-173170259 CGCCGAGGCGGCGGGGCTGCAGG + Intronic
984811094 4:183797356-183797378 CTCCGCCCCCGCGGGGCCGCTGG + Intergenic
985564624 5:609085-609107 TGCCGCTGCCATGGGGCTGATGG + Intergenic
985727500 5:1523832-1523854 CGGCGCGGCCATGAGGCTGCGGG - Exonic
985784503 5:1886880-1886902 CGCCCGCGCCGTGTGGCTGCCGG + Exonic
986721626 5:10564458-10564480 GGCCGCCGGCATGGTGCTGCTGG + Exonic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
996379117 5:122845769-122845791 CGCCGCCGCCTTGGCGCAGGGGG + Intronic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997980832 5:138466466-138466488 AGCCGCGGCCATGGGGGTGCTGG + Intronic
998119039 5:139561334-139561356 CGCCGCCGGGGTGGGGCCGTCGG - Exonic
998419253 5:141968982-141969004 CAGCGCCGCCTTGGGCCTGCGGG + Intronic
1002193757 5:177491660-177491682 GGCGGCCGGGGTGGGGCTGCAGG - Intronic
1002591080 5:180291990-180292012 CGCCGCCGCAGTGGGTGTGAGGG + Exonic
1002901879 6:1416527-1416549 CGCCGCCTGCGGGGAGCTGCTGG + Intergenic
1003551727 6:7107382-7107404 CGCCCGCGGCGAGGGGCTGCAGG + Intergenic
1004274479 6:14223155-14223177 CACAGCAGGCGTGGGGCTGCGGG - Intergenic
1005705473 6:28447276-28447298 CGCTGTCGCCGTGGGCATGCTGG + Intergenic
1006610495 6:35291667-35291689 CGCGGCCACAGTGGGGCTCCGGG - Exonic
1007387964 6:41532085-41532107 GACTGCTGCCGTGGGGCTGCCGG + Intergenic
1007689213 6:43687834-43687856 CGCCGCCGCAGTGGTGGGGCAGG + Intergenic
1008070804 6:47097052-47097074 CGCCACTGACTTGGGGCTGCAGG + Intergenic
1010703400 6:79078103-79078125 CCCCGCCGCCGAGGGGAAGCGGG + Exonic
1011516983 6:88166037-88166059 CGGCGCCGGCGCCGGGCTGCTGG + Exonic
1011643081 6:89433257-89433279 CGCCGAGGCCCTGGGGCCGCCGG + Intronic
1013459017 6:110358009-110358031 GGGCGCCGCCGGGGGGCGGCGGG - Exonic
1015773466 6:136791993-136792015 CGCCGCCGCCGGGCAGCTTCTGG - Exonic
1016118020 6:140312813-140312835 CCCCGCCCCCGTGGCTCTGCAGG + Intergenic
1016738869 6:147508174-147508196 CCCCAGCGCCGTGGGGCGGCGGG + Intergenic
1017127387 6:151078850-151078872 CGCCGCCACAGTGTGGCTCCAGG + Intronic
1017337809 6:153282637-153282659 CGCGGCCGCCGGGGTGCTTCCGG + Intergenic
1017989106 6:159470896-159470918 CACCACCGCCGTGGCTCTGCAGG + Intergenic
1018171947 6:161150670-161150692 CACCCCCGCCTTGGGGCTGAAGG + Intronic
1018774213 6:166998864-166998886 CGGCGCCCCCCCGGGGCTGCAGG + Intergenic
1019032275 6:169023997-169024019 TGCGGCCGCCCTGGGGCTGCGGG - Intergenic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1019197181 6:170289692-170289714 GGCCACCGCCGTGCGCCTGCCGG - Exonic
1019501950 7:1369077-1369099 CGGCGCCCCTGGGGGGCTGCGGG - Intergenic
1019547579 7:1585893-1585915 CGCCGCCACCCCAGGGCTGCCGG - Intergenic
1019644872 7:2123739-2123761 CTCCGGCGGCGTGGTGCTGCAGG + Intronic
1020268437 7:6577503-6577525 GGCCGCCTCCGCGGGGCTGTGGG + Exonic
1020461397 7:8433668-8433690 CGCCTCCGACCTGTGGCTGCCGG - Intergenic
1021450329 7:20778260-20778282 CGCCGCTCCCCTCGGGCTGCGGG - Intergenic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1023016346 7:35971610-35971632 CGCCGCCGCCTTCGGGAGGCCGG + Intergenic
1023918247 7:44606744-44606766 CGCCGCGCCCTTGGTGCTGCGGG + Intronic
1024579920 7:50793242-50793264 CGCCGCCTCCGCGTGGCTGCGGG + Intronic
1025089646 7:56051701-56051723 CGCCGCCGCCATTGGGCCACAGG - Exonic
1025478640 7:60956872-60956894 CCCCACCGCCGTGGGTCTGAGGG + Intergenic
1026894262 7:74000851-74000873 AGCGGCCGCCCTGGGGCTGCAGG + Intergenic
1029281556 7:99438941-99438963 CGCCGCCGCCCGAGGGATGCCGG - Intronic
1029422259 7:100477720-100477742 CGCCGAAGCTGTGGGGCTCCAGG + Exonic
1029453456 7:100655556-100655578 CCCCACCACAGTGGGGCTGCTGG - Exonic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1032130756 7:129225361-129225383 CGCCGCCGTCGCGGTGCCGCTGG - Exonic
1032391277 7:131556701-131556723 CGCCGCCGCTGGCGGGCTCCTGG - Intronic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034491611 7:151396003-151396025 GGCCGCGGCCGGGGGGCTTCTGG - Exonic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035222425 7:157414089-157414111 CTCACCCGCCCTGGGGCTGCCGG - Intronic
1036733238 8:11284570-11284592 CGCCGCTGCCGTTGGGCTCCGGG - Exonic
1037881565 8:22575813-22575835 AGCTGCCACCGTGGGGTTGCTGG + Intergenic
1037947797 8:22999968-22999990 CGGCGCCGCCGCGCTGCTGCTGG - Intronic
1039579319 8:38651019-38651041 CGGCGCTGCCGTGGGGTGGCCGG + Intergenic
1040563157 8:48542508-48542530 TGCCCCCTCCGTGGGCCTGCTGG - Intergenic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1042020568 8:64369383-64369405 CTTCGCGGCCGAGGGGCTGCCGG + Intergenic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1046932533 8:119855819-119855841 CGCCGCGCCCGGGTGGCTGCGGG + Exonic
1049109750 8:140635509-140635531 TGGCGCCGCCGAGGGGCTCCGGG + Exonic
1049589230 8:143448589-143448611 CTCCGCCGCCATGGCTCTGCAGG + Intronic
1049784651 8:144444568-144444590 CGCCGCCGCCGTCGAGGGGCGGG - Intergenic
1050091024 9:2016525-2016547 AGCCGCCGCCGTGGCTCTCCTGG - Intronic
1050345285 9:4679872-4679894 CGCCGCCGCCTGGCAGCTGCGGG - Exonic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1056382221 9:86065617-86065639 AGTGGCCGGCGTGGGGCTGCCGG - Intronic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1060375451 9:123112320-123112342 CGCCTGCCCCGCGGGGCTGCTGG + Intronic
1060790549 9:126482882-126482904 GGCCCCCGTAGTGGGGCTGCGGG - Intronic
1061134259 9:128724159-128724181 CGCCGCCGCCCGGGGACTGGTGG + Intergenic
1061541069 9:131278014-131278036 CGCCGGCCCCGCGGGGATGCAGG + Intergenic
1062341409 9:136095304-136095326 CCCCGCCGCGGTGCGGCCGCCGG - Intergenic
1062626044 9:137441849-137441871 GGCCGCCGCCGTCGGGGTCCGGG + Intergenic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1190181666 X:48197609-48197631 CGCCGCAGCCCTGGGACTACAGG + Intronic
1199793819 X:151177424-151177446 CGCCGCGGCCCTGGGGCTCCAGG + Intronic