ID: 982719899

View in Genome Browser
Species Human (GRCh38)
Location 4:158848620-158848642
Sequence TGGACTAAATACAGCACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982719893_982719899 1 Left 982719893 4:158848596-158848618 CCAGGATCACGTTACCTCACCAA 0: 1
1: 0
2: 0
3: 17
4: 404
Right 982719899 4:158848620-158848642 TGGACTAAATACAGCACCAGGGG 0: 1
1: 0
2: 3
3: 23
4: 118
982719892_982719899 5 Left 982719892 4:158848592-158848614 CCATCCAGGATCACGTTACCTCA 0: 1
1: 0
2: 0
3: 20
4: 347
Right 982719899 4:158848620-158848642 TGGACTAAATACAGCACCAGGGG 0: 1
1: 0
2: 3
3: 23
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982719899 Original CRISPR TGGACTAAATACAGCACCAG GGG Intronic
902624375 1:17668047-17668069 TGGAATGAAAACAGTACCAGTGG + Intronic
902819876 1:18937362-18937384 GTGACTAAATACAGCTCAAGGGG + Intronic
903294972 1:22337936-22337958 TGTACTAAACACAGGGCCAGGGG - Intergenic
905215574 1:36405062-36405084 TAGAGGAAATACAGCCCCAGAGG - Intergenic
905360894 1:37419601-37419623 TGGACTTAAGACAGCAAAAGGGG + Intergenic
911853151 1:102843420-102843442 TGGACTAAATAAGGCACCAGGGG + Intergenic
914904476 1:151732570-151732592 TGTACTTCATACATCACCAGGGG - Intergenic
914912570 1:151799631-151799653 TGCACTAAGCACAGAACCAGAGG + Intergenic
915659842 1:157394417-157394439 TGAACTAAATAATGCACCAAGGG - Intergenic
919644857 1:200085326-200085348 TCAATCAAATACAGCACCAGGGG - Intronic
919796321 1:201323398-201323420 TGGACAGAATCCAGCATCAGTGG - Intronic
923907205 1:238398472-238398494 TTTACCAAATACAGCAACAGTGG - Intergenic
1068478630 10:57561763-57561785 TGAACTAAATAAGGCAACAGGGG - Intergenic
1070637009 10:78137180-78137202 TGTGCTAAAAACAGCACAAGAGG - Intergenic
1076021925 10:127081034-127081056 TTGCCAAAATACAGCACCATGGG - Intronic
1077276754 11:1715077-1715099 TGGACTAAGCACAGAGCCAGGGG - Intergenic
1079841377 11:25404279-25404301 TGAAATATGTACAGCACCAGTGG + Intergenic
1081244514 11:40747295-40747317 TTGACTATATACAGCATCAGTGG - Intronic
1083506677 11:63164076-63164098 TGGAGTAAAAACAGCAACAGAGG + Intronic
1086007143 11:82049850-82049872 TTAACTAAATAAGGCACCAGGGG + Intergenic
1089113754 11:116077844-116077866 TGGATTAAAGAGAGCCCCAGTGG + Intergenic
1091612191 12:2020536-2020558 TGGACTACTTACGGCAGCAGAGG + Intronic
1091613349 12:2030573-2030595 TGGACAAAATGCAGCCCCAAGGG - Intronic
1095227688 12:39696241-39696263 TGAACTAAATAACGCACCAAGGG + Intronic
1097508774 12:60508681-60508703 TGAACTAAATAAGGCACTAGGGG + Intergenic
1100578734 12:95918455-95918477 TGGAGGAAATACAGTAACAGAGG - Intronic
1100724508 12:97394771-97394793 TGGAGTGAATACAACACCAGGGG - Intergenic
1105558869 13:21472259-21472281 TGAACTAAGTAGGGCACCAGGGG - Intergenic
1107999684 13:45894764-45894786 TGGCCTGATTACAGCACCATAGG + Intergenic
1110305257 13:73979661-73979683 TAAACTAAATAAAGCACAAGGGG + Intronic
1110360750 13:74622200-74622222 TGAACTTAATAAACCACCAGTGG + Intergenic
1115217229 14:31025958-31025980 TGCACTACATCCAGCACGAGTGG - Exonic
1115861352 14:37688958-37688980 TGAACTAAATAAGGCACCAAGGG + Intronic
1120152517 14:81053155-81053177 TGGACTAAATTCTACACCACAGG - Intronic
1124128623 15:26964522-26964544 TGGACTAAAAACAGACCAAGTGG + Intergenic
1124400800 15:29345739-29345761 TGGGCTAAAAACAACCCCAGCGG + Intronic
1128719394 15:69935345-69935367 AGAACAAAATAAAGCACCAGTGG + Intergenic
1129998987 15:80031121-80031143 TGTATTAAATACATTACCAGGGG + Intergenic
1131894655 15:97013092-97013114 TGAAGTAAATACAGCACGAGCGG - Intergenic
1137225842 16:46507337-46507359 TGAACTAAATAAGGCACCAGGGG + Intergenic
1143413843 17:6730285-6730307 TGAACTAAATAAGGAACCAGGGG - Intergenic
1145800364 17:27679103-27679125 TGGATAAACTACAGCAGCAGGGG - Intergenic
1146789071 17:35741524-35741546 TGCACTAAATACAGCACTGAAGG - Exonic
1147572789 17:41581727-41581749 AGGATTAGATCCAGCACCAGAGG + Intergenic
1149092690 17:52803530-52803552 TGAACTAAATAAGGCACCAGGGG - Intergenic
1149615633 17:57995589-57995611 TGGATCAAAGACAGCACCATGGG + Intronic
1153669316 18:7395099-7395121 TGGACTAAATGCAGTTCCAGGGG - Intergenic
1155282296 18:24251719-24251741 TGAACTAAATAAGGCAGCAGGGG + Intronic
1156155997 18:34302097-34302119 TGAACTAAATAAGGAACCAGAGG + Intergenic
1156806312 18:41186699-41186721 AAGATTAAATACAGCACCAGTGG - Intergenic
1158512086 18:58099625-58099647 TGCATTAAACACAACACCAGCGG + Intronic
1162666611 19:12219228-12219250 TGAACTAAATAAGGCACCAGGGG - Intergenic
1164604101 19:29583655-29583677 TGGCCTGAAGACAGCAGCAGGGG + Intergenic
1166559244 19:43720853-43720875 TGTACCAAAGACAGCCCCAGGGG + Intergenic
926767936 2:16338508-16338530 TTGGCTAAAAACAGCATCAGTGG - Intergenic
935356445 2:102206240-102206262 TGAATTAAATAAGGCACCAGGGG - Intronic
935554975 2:104499467-104499489 AGGACTAATTGCAGGACCAGAGG - Intergenic
939142800 2:138376244-138376266 TGAATTAAATCAAGCACCAGTGG + Intergenic
939411503 2:141831870-141831892 TTAGCTAAAAACAGCACCAGTGG + Intronic
940733095 2:157417115-157417137 AGGACAAAAGACAGCAGCAGTGG - Intronic
942734546 2:179095658-179095680 TGAACTAAATAATGCACCAGGGG - Intergenic
949078359 2:242075929-242075951 TGGAATGAATACAGCACAGGAGG - Intergenic
1168741910 20:199386-199408 TGGACTAAATAAGGCAGGAGGGG - Intergenic
1170063906 20:12289775-12289797 TTGACTAAAATCAGGACCAGAGG - Intergenic
1171282284 20:23910849-23910871 TGGAAGCAATACAGAACCAGGGG - Intergenic
1176254293 20:64142816-64142838 TGGAGTAAATAGAGCACTAAAGG + Intergenic
1176737315 21:10562404-10562426 TGAACTAAATAAGACACCAGGGG + Intronic
1176912225 21:14579871-14579893 TGAACTAATTCCAGCACAAGTGG + Intronic
1177108401 21:16991541-16991563 TGGACTAAATATATCACTACAGG - Intergenic
1180563321 22:16639950-16639972 TGAACTAAATAAGACACCAGGGG + Intergenic
1182925670 22:34121993-34122015 TGGAATAAATACTGACCCAGTGG + Intergenic
1183531809 22:38360189-38360211 TGAACTAAATAAGACACCAGGGG - Intronic
953505263 3:43479905-43479927 TGAACTACAGGCAGCACCAGGGG + Intronic
953910707 3:46891533-46891555 TGGAGAAAATACAGCACAATGGG + Intronic
956705813 3:71998150-71998172 TGCACTCATTCCAGCACCAGAGG + Intergenic
958491261 3:94776780-94776802 TGGACAAAATACAGCAGCTGTGG - Intergenic
960240874 3:115340357-115340379 TGGATTAAAGCCAGCACAAGGGG + Intergenic
960551319 3:118978665-118978687 TTGACTATAAACAGCATCAGTGG - Intronic
962465682 3:135655733-135655755 TGAACTAAATAAAGCACCAGTGG + Intergenic
963404979 3:144852583-144852605 TTTACTAAACACAGCACCTGCGG + Intergenic
965019966 3:163217022-163217044 CAGACTAAATAAGGCACCAGAGG - Intergenic
965442407 3:168730494-168730516 TGGACAAAATAAGGCATCAGAGG + Intergenic
965854103 3:173066813-173066835 TGGTCTAAATAAGGCACCAGTGG + Intronic
968004819 3:195235511-195235533 TGAACTAAATAAGGCACCAGGGG - Intronic
968018223 3:195358380-195358402 AGAACTAAATAAGGCACCAGGGG + Intronic
968545939 4:1198559-1198581 AGGACTCAATGCAGCATCAGCGG + Intronic
974301165 4:60068373-60068395 TGGACAAAATAAGGCATCAGGGG + Intergenic
975675092 4:76820185-76820207 TGAACTAAATCAGGCACCAGTGG - Intergenic
977529471 4:98183160-98183182 AGGACTAAAGATAGAACCAGAGG - Intergenic
979630936 4:122901979-122902001 TGGAGTAAAGACAGAACAAGAGG - Intronic
979675639 4:123407749-123407771 TGGACTAAACAAAGCATCATTGG - Intergenic
982220872 4:153124185-153124207 AAGACTAAATACAGCAAAAGTGG - Intergenic
982605363 4:157509559-157509581 TTGTCTAAACACAGCACCAATGG + Intergenic
982719899 4:158848620-158848642 TGGACTAAATACAGCACCAGGGG + Intronic
983586477 4:169361084-169361106 TAAACTAAACAAAGCACCAGGGG - Intergenic
988789222 5:34592048-34592070 TGGACTAACTGCAGCAGAAGGGG - Intergenic
989671531 5:43923679-43923701 TGAACTAAATAAGACACCAGGGG - Intergenic
991208992 5:64083401-64083423 TGAACAAAATAAAGCACCAGGGG - Intergenic
991326628 5:65440527-65440549 AGGACTAAGTACAGCAGCAGAGG + Intronic
999334310 5:150702098-150702120 TGGACTAACTACAGAAACAAGGG - Intergenic
1000845896 5:166280108-166280130 CGGCCTAAAAACAGCAGCAGGGG + Intergenic
1004014233 6:11717874-11717896 TTGACTAAATGCTGCCCCAGTGG + Intronic
1004981331 6:21028000-21028022 TGGACTAAACACAGGAACTGAGG + Intronic
1006268987 6:32949513-32949535 TGGACTAAACAAGGTACCAGTGG + Intronic
1006991143 6:38215956-38215978 TTGCCTAAATACTGCCCCAGGGG + Intronic
1012288257 6:97420738-97420760 TGAACTAAATAAGGCACCAGGGG - Intergenic
1014946281 6:127502460-127502482 AGGACTAAATACAGGCCTAGTGG + Intronic
1017336320 6:153264716-153264738 GGGCCTAAATACAACAACAGGGG + Intergenic
1021430868 7:20557364-20557386 TGGCCTAAAGACAGAGCCAGAGG + Intergenic
1022034408 7:26520033-26520055 TGGACTAAACACGGCATCAATGG + Intergenic
1022080371 7:27013723-27013745 TGAACTAAATAAGGCACCAGAGG + Intergenic
1029797135 7:102908406-102908428 TGAACTAAATAAGGCACCAAGGG - Intronic
1031215405 7:118883706-118883728 TGAACTAAATAAGGCACCAGGGG + Intergenic
1031722088 7:125188488-125188510 TGAACTAAATACAGCACAAGTGG + Intergenic
1032533046 7:132637673-132637695 TGGAGTAACTACATCACAAGTGG - Intronic
1033541835 7:142364632-142364654 TGAACCAAATAAAGCACCAGAGG - Intergenic
1035442542 7:158914251-158914273 TGGCATAACTACAGCATCAGAGG - Exonic
1035536625 8:395952-395974 TGGAATGAATACAGCACAGGAGG - Intergenic
1037353983 8:17998157-17998179 GGGACCAAATAAGGCACCAGTGG - Intronic
1038978733 8:32732261-32732283 AGGACTACATAAAGCATCAGAGG - Intronic
1048094992 8:131282671-131282693 TGGCCTAAATACAGCAGAATGGG - Intergenic
1050578596 9:7027083-7027105 TAAACTAAATAAGGCACCAGGGG - Intronic
1051328344 9:15997603-15997625 TAGATCAAATACAGCAACAGGGG - Intronic
1051992223 9:23164568-23164590 TGAACTAAATAAGGCACCAAGGG + Intergenic
1052210657 9:25899215-25899237 TGGACAAAATAGAGGACCAAAGG + Intergenic
1052600427 9:30621214-30621236 TGGACTACATAAAGCCTCAGAGG - Intergenic
1057090525 9:92254166-92254188 TCGAGTAAAAACAGCATCAGAGG + Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1059087770 9:111322656-111322678 TGCATCAAATACAGTACCAGAGG + Intergenic
1061617477 9:131789965-131789987 AGGACTCCATTCAGCACCAGTGG - Intergenic
1191599980 X:62992960-62992982 TTGACTAAATAAGGCATCAGTGG - Intergenic
1191801081 X:65079869-65079891 TGAACTAAATAAACCACCAGGGG + Intergenic
1192060347 X:67817810-67817832 TGAACTAAATAATGCATCAGGGG + Intergenic
1193260941 X:79405155-79405177 TGAACTAAATAAGGCACCAGGGG + Intergenic
1193489550 X:82132611-82132633 TGAACTAAATAAGGTACCAGGGG + Intergenic
1193986679 X:88251647-88251669 TGAACTAAATAAGGCACTAGGGG - Intergenic
1194757659 X:97756607-97756629 TGAAATAAATATAGCACCATAGG - Intergenic
1195851997 X:109294094-109294116 TGAACTAAATAAGGCACCAGGGG - Intergenic
1196113395 X:111971232-111971254 TGGGTTAGATACAGCACCAAAGG + Intronic
1196511952 X:116522784-116522806 TGAGCTAAATAAGGCACCAGGGG - Intergenic
1197139278 X:123097829-123097851 TGAACTAAATAAGGCACCAGGGG + Intergenic
1197953303 X:131920199-131920221 TTAACTAAATGAAGCACCAGGGG + Intergenic
1198664550 X:139005580-139005602 TGAACTCAATAAGGCACCAGAGG + Intronic
1200169328 X:154060942-154060964 AGGACTAAACAAAGAACCAGGGG + Intronic