ID: 982719942

View in Genome Browser
Species Human (GRCh38)
Location 4:158849020-158849042
Sequence GAGATCAAGAAGAATCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982719942_982719949 25 Left 982719942 4:158849020-158849042 CCATCCTGATTCTTCTTGATCTC 0: 1
1: 0
2: 3
3: 35
4: 427
Right 982719949 4:158849068-158849090 GTATAGGACTGGACCCCTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 76
982719942_982719947 14 Left 982719942 4:158849020-158849042 CCATCCTGATTCTTCTTGATCTC 0: 1
1: 0
2: 3
3: 35
4: 427
Right 982719947 4:158849057-158849079 CTTCCTGTCAGGTATAGGACTGG 0: 1
1: 0
2: 3
3: 24
4: 118
982719942_982719946 9 Left 982719942 4:158849020-158849042 CCATCCTGATTCTTCTTGATCTC 0: 1
1: 0
2: 3
3: 35
4: 427
Right 982719946 4:158849052-158849074 CATTTCTTCCTGTCAGGTATAGG 0: 1
1: 2
2: 8
3: 59
4: 263
982719942_982719945 3 Left 982719942 4:158849020-158849042 CCATCCTGATTCTTCTTGATCTC 0: 1
1: 0
2: 3
3: 35
4: 427
Right 982719945 4:158849046-158849068 GTGTGGCATTTCTTCCTGTCAGG 0: 1
1: 0
2: 5
3: 32
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982719942 Original CRISPR GAGATCAAGAAGAATCAGGA TGG (reversed) Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900503516 1:3017989-3018011 CAGAGCCAGAAGAAGCAGGAAGG - Intergenic
900809688 1:4792691-4792713 GAGATAATGAAGATTCAGGGAGG - Intergenic
902546766 1:17195144-17195166 CAGATCATGAGGGATCAGGATGG + Intergenic
904768681 1:32869456-32869478 GAGATCGAGAAGTGTCAGGCTGG + Intronic
904978961 1:34480273-34480295 GGGAGCAAGAGGAATAAGGAAGG + Intergenic
905565660 1:38962479-38962501 GAGATCAAGAGGAATTTAGAAGG - Intergenic
905762144 1:40568354-40568376 GAAATCAAGAAGAAAAAGCATGG + Intergenic
906081443 1:43091577-43091599 GAGATTAATAAGAAACAGAATGG - Intergenic
906880974 1:49589859-49589881 AAGATAAAGAAAAATAAGGAAGG - Intronic
907263048 1:53236564-53236586 GAGACGAAGAAGAGTCAAGAAGG - Intronic
908371102 1:63478357-63478379 GAGATCTAGAGGAACCTGGAAGG - Intronic
908460996 1:64348271-64348293 CAAAGCCAGAAGAATCAGGAAGG + Intergenic
909961278 1:81846686-81846708 GAGAAAAAGAAGAATCAGTAAGG - Intronic
910619453 1:89236585-89236607 GAGAACAAGAAAAAGCAGGGTGG - Intergenic
910723456 1:90313012-90313034 GAGAACAAGCAGAGTAAGGAAGG + Intergenic
912503275 1:110136726-110136748 GAAAACAAGAAGACTCAGAAAGG - Intergenic
912843149 1:113057140-113057162 CAGAACAAGAAGAACCAGGCAGG - Intergenic
913121485 1:115745213-115745235 GGGAGAAAGAAGAATCAGGAAGG + Intronic
913312584 1:117516376-117516398 GTCATCATGAAGAATCAGAAAGG + Intronic
914464122 1:147910882-147910904 GGGAACAAGAAGAATCTTGAAGG + Intergenic
914932890 1:151950388-151950410 GACTTCAAGAAGAAGTAGGAGGG - Intergenic
914989323 1:152484944-152484966 GAGATCAGGAGGCAACAGGAAGG - Intergenic
915592163 1:156876672-156876694 GACACCAAGAAAGATCAGGAAGG + Intronic
915629674 1:157142544-157142566 GAGATCACGAAGGAACAGAATGG + Intergenic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
916149907 1:161776930-161776952 GAGATGAGGAAGAACCAGCAAGG + Intronic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917315580 1:173721588-173721610 GAGACCAAGATGGAGCAGGAAGG - Intronic
917345912 1:174027973-174027995 GGGATGAAGAAGGATAAGGAAGG + Intergenic
917704683 1:177620121-177620143 GAGATCAAAAAGGAAGAGGAAGG - Intergenic
918469600 1:184858237-184858259 GAGAACAAGAAAAAGAAGGAAGG + Intronic
918615304 1:186537333-186537355 GAGACAAAGAAGAATCAGAGTGG - Intergenic
919001902 1:191843198-191843220 GAGATAAAGAGGAAACAGGAAGG + Intergenic
920874465 1:209821396-209821418 CAGATGAAGAAGAACCAGCAAGG - Intergenic
921685057 1:218080560-218080582 TAGATAAAGAAGAATAAGAAAGG + Intergenic
921765476 1:218967842-218967864 GTCATCTAAAAGAATCAGGATGG - Intergenic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
923594678 1:235351920-235351942 GTGATTAGGAAGAATTAGGATGG - Intergenic
923705143 1:236337820-236337842 GATATCAAGAAGGATCAGATAGG + Intergenic
923872270 1:238008625-238008647 GAAATGTAGAAGAATCAAGAAGG + Intergenic
1063879747 10:10518944-10518966 CAGACCAAAAAGAATCAGGAAGG + Intergenic
1065334711 10:24644744-24644766 CAGAGAAAGAAGAATCAGAAAGG - Intronic
1065485542 10:26233444-26233466 GGGTTCAAGAAGATGCAGGACGG - Intronic
1065966984 10:30778724-30778746 GAGAAGAAGAAGGATAAGGAGGG + Intergenic
1066391337 10:34979535-34979557 GAAATAAAAAAGAATCAGGCGGG + Intergenic
1068027495 10:51665703-51665725 GAGATCAAGAAATAGAAGGAGGG - Intronic
1068656662 10:59583083-59583105 AAGAGCCAGAAGAATCAGTATGG - Intergenic
1069772022 10:70906165-70906187 GAGAGTAAGAAGAAACAGGATGG - Intergenic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1071102825 10:82059420-82059442 GAGAAAAAGAAGAATCAAGGAGG + Intronic
1072000357 10:91189253-91189275 GAGATGACCAAGAATCATGAGGG - Intronic
1072613353 10:97033815-97033837 GACAGCAATAAGGATCAGGAAGG + Intronic
1072977470 10:100071541-100071563 GAGGTCACCTAGAATCAGGATGG - Intronic
1073452308 10:103617212-103617234 GTGATCCGGAAGAATCTGGAAGG - Exonic
1073514798 10:104066676-104066698 GAGATCAGGGAGTAACAGGAAGG + Intronic
1075713431 10:124542744-124542766 GCGATCAAGAAGAGGCAGCAGGG - Intronic
1076929974 10:133525701-133525723 GAGAACAGGAAGCATCAGGGTGG - Intronic
1077391119 11:2301072-2301094 GAGAACCAGGAGAACCAGGAGGG - Intronic
1077826986 11:5821227-5821249 AAGACCAAGCAGATTCAGGAAGG + Exonic
1078398995 11:11007725-11007747 GAGAACAAGAGGAAGCAGGAGGG - Intergenic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079318948 11:19433981-19434003 GAGAGCAAGAAGTATCATGCAGG + Intronic
1080424414 11:32143096-32143118 GAGATCAAGAGGAAGCTGGATGG - Intergenic
1080976115 11:37342338-37342360 GAAATGAAGATAAATCAGGAAGG + Intergenic
1083149264 11:60781683-60781705 GAGCTCACGGAGACTCAGGATGG - Intergenic
1085258063 11:75188169-75188191 GAGTCCACGAAGAAGCAGGATGG + Exonic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1086221503 11:84450565-84450587 GAGATCAGGGAGAATGATGAAGG + Intronic
1086863002 11:91947404-91947426 AGGATCCAGAAGAGTCAGGAGGG + Intergenic
1087779338 11:102286485-102286507 GAGGCCAAGAAGAATCTGAACGG + Intergenic
1088579538 11:111301051-111301073 GAGTTCCAGAAGAATGAGGAGGG - Intronic
1088982982 11:114880629-114880651 GAGGTCAAGAACACTCAGCAGGG + Intergenic
1091596799 12:1883826-1883848 GGGACCAAGAGGGATCAGGATGG - Intronic
1091899511 12:4133762-4133784 GAAGTGAAGAAGAAACAGGAGGG + Intergenic
1092601805 12:10074593-10074615 GAGAATAAGAAAAATTAGGAGGG + Intronic
1092678897 12:10954817-10954839 AAGATCAAGAAGAAACAGAAGGG + Intronic
1093352877 12:18126053-18126075 GAGATAAATAAGAAACAGGCTGG - Intronic
1093636507 12:21477156-21477178 AAGATCAAGAAGAGTCTGGGAGG - Intronic
1094669848 12:32559040-32559062 AATATCAAGAAGAACCAGTAGGG - Intronic
1095993962 12:48062436-48062458 GTGACCAAGAATAATAAGGAAGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1097533360 12:60834376-60834398 TAGAGAAAGAAGAATCAAGATGG + Intergenic
1098174782 12:67779412-67779434 GCAATAAAGAAGAATCAGAAAGG - Intergenic
1098880251 12:75909896-75909918 GAGATTAACAAGAAACAGTATGG + Intergenic
1098982754 12:76975396-76975418 GAGATAAAGAATAATAAAGAGGG - Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099913464 12:88862332-88862354 GAGACAAAGAAGACTCAGAATGG - Intergenic
1100110916 12:91241831-91241853 GAAAGCTAGAAGAATCAGCATGG - Intergenic
1100372691 12:93983034-93983056 GAGATAAAGATCAGTCAGGAAGG + Intergenic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1101187308 12:102292545-102292567 GAGAGCAAGAAAAAGCAGGGTGG - Intergenic
1101372342 12:104140905-104140927 GAGCAAGAGAAGAATCAGGAAGG - Intergenic
1102509994 12:113408689-113408711 TAAATCAAGAAGTATCAGGCCGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103859726 12:124002706-124002728 GAGATGGGGAAGAATGAGGAAGG + Intronic
1104584881 12:130039953-130039975 GAGAACAACAAGTATCAAGAAGG + Intergenic
1105531170 13:21221880-21221902 GAGACCAAGAAGAATCTGAAGGG + Intergenic
1105934352 13:25085531-25085553 GAGATTAATAAGAAGCAGAATGG + Intergenic
1105984370 13:25550716-25550738 AGGACCAAGAAGAGTCAGGAAGG - Intronic
1106039195 13:26073646-26073668 TAGATCTAAAAGAATCAGGCCGG - Intergenic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107314310 13:39114626-39114648 GAGATCATGGAGAAATAGGAAGG - Intergenic
1107597979 13:41983525-41983547 AAGATAAGGAAGAATGAGGAAGG - Intergenic
1108732547 13:53249504-53249526 GACATGAAGAAGGATGAGGATGG + Intergenic
1109928347 13:69178420-69178442 GAGATAAAGAAGTATTAGGTTGG + Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1110821922 13:79926394-79926416 GAGAGCAAGAAGAAACAGAGTGG - Intergenic
1111073131 13:83196345-83196367 GAGATGTAAAAGATTCAGGATGG + Intergenic
1111190198 13:84796632-84796654 GATATTAAGAATAACCAGGAAGG + Intergenic
1111522983 13:89428735-89428757 GAGAACAACAAAAAGCAGGATGG - Intergenic
1112552754 13:100436930-100436952 GAGAGCAAAAAGAAACAAGAGGG + Intronic
1112664260 13:101551501-101551523 GGGAGCAAGATGGATCAGGAAGG + Intronic
1113780482 13:112973957-112973979 GAGATCAGGAAGACGCTGGAAGG - Intronic
1114011925 14:18378319-18378341 GAAACCAAGAAGAATAAGGTAGG + Intergenic
1114133820 14:19823843-19823865 GAGAAAAAGAAAAATAAGGAAGG + Intronic
1114733675 14:25021202-25021224 GAGAACAAGATGCAACAGGAGGG - Intronic
1116307518 14:43277360-43277382 AAGACCAAGAAGAATAAGGCAGG + Intergenic
1116620311 14:47193512-47193534 GAGATCAAAGATAAACAGGATGG - Intronic
1116628404 14:47297387-47297409 GAGAGAAAGAAGAAAGAGGAAGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117871849 14:60209431-60209453 GAGATCATCAGGAATTAGGAGGG - Intergenic
1118685383 14:68285566-68285588 GAGAGCTAGAAGTATCAGGACGG + Intronic
1118821751 14:69350480-69350502 AAGAGCATGAAGAAACAGGAGGG + Intronic
1118910133 14:70055192-70055214 GTGAACAAGATGAATTAGGATGG - Intronic
1119543751 14:75457276-75457298 GAATTCAAGAAGCACCAGGAAGG + Intronic
1119675193 14:76548230-76548252 AAGAGCAAGAAGAACCAGAAGGG - Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121818658 14:96947700-96947722 GAGATCTAGAAAAATCTAGAGGG + Intergenic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123142052 14:106089377-106089399 GAGAGCAAGAGGAATCCTGAGGG - Intergenic
1123576891 15:21679430-21679452 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1123613513 15:22121898-22121920 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1124037856 15:26072869-26072891 GAGATCAAGCAGCATTAGGAAGG - Intergenic
1126663965 15:51058745-51058767 GTGAGCTAGTAGAATCAGGAAGG - Intronic
1127572625 15:60259120-60259142 GAGTTCAGGGAGGATCAGGAAGG - Intergenic
1127907157 15:63384329-63384351 GAGGTCAAGAAGAATTGGAACGG + Intergenic
1127986344 15:64074754-64074776 GATACCAAGAAGACTCAGAAAGG - Intronic
1129423335 15:75447750-75447772 GACACCAAGAAGACTCATGAAGG + Intronic
1129797938 15:78392151-78392173 GAGATGAGGATGAATGAGGATGG - Intergenic
1130129495 15:81127124-81127146 GAGATTAATAAGAAACAGAATGG - Intronic
1132226854 15:100149476-100149498 GTGACCAGGATGAATCAGGACGG - Intronic
1202985759 15_KI270727v1_random:413675-413697 GAGAAAAAGAAAAATAAGGAAGG + Intergenic
1132543147 16:520828-520850 GAGGTCAAGTAGAGGCAGGAAGG + Exonic
1133084325 16:3350005-3350027 GTCAGCAAGAAGAGTCAGGAAGG + Intergenic
1133327228 16:4949154-4949176 GAGACCCAGGAGAACCAGGAAGG - Intronic
1133795148 16:9040256-9040278 GAGAGCAAGATGAAGCTGGAAGG + Intergenic
1134062007 16:11204981-11205003 GGGATCCAGAAGACTAAGGAAGG - Intergenic
1137594147 16:49712833-49712855 GAGGTCAAGGAAAAGCAGGAAGG - Intronic
1138992672 16:62410157-62410179 GTGACCAAGAAGAATGAGGTAGG + Intergenic
1140133509 16:72184750-72184772 AAGACAAAGAAGAATCAAGATGG - Intergenic
1141617491 16:85218346-85218368 GAGGCCATGAAGACTCAGGAAGG - Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1144725593 17:17500454-17500476 AACTTCAAGAAGAAGCAGGAGGG - Intergenic
1146032367 17:29377167-29377189 AAGAGAAAGAAGGATCAGGAAGG - Intergenic
1146341482 17:32022891-32022913 GAGATAAAGAAGGCCCAGGAAGG - Intronic
1146812148 17:35912545-35912567 GAGATAAAGAAGGCCCAGGAAGG + Intergenic
1147232966 17:39032503-39032525 GAGATAAAGAAGGCCCAGGAAGG - Intergenic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1148173855 17:45547639-45547661 GAGATAAAGAAGGCCCAGGAAGG + Intergenic
1148275413 17:46297808-46297830 GAGATAAAGAAGGCCCAGGAAGG - Intronic
1148297518 17:46515387-46515409 GAGATAAAGAAGGCCCAGGAAGG - Intronic
1148362070 17:47019866-47019888 GAGATAAAGAAGGCCCAGGAAGG - Intronic
1149015767 17:51906746-51906768 GAGATAGAGAAGACTGAGGAAGG - Intronic
1150033554 17:61767999-61768021 GAGATTAAGAAGAATGATAATGG - Intronic
1150405068 17:64894561-64894583 GAGATAAAGAAGGCCCAGGAAGG + Intronic
1150506647 17:65705568-65705590 GAGAACAAAAAGAAAAAGGAAGG + Intronic
1150727936 17:67666652-67666674 GAGATTGAGAAGAGGCAGGAGGG + Intronic
1150734693 17:67726787-67726809 CAATTCAAGAAGAATTAGGAAGG - Intronic
1150784102 17:68149173-68149195 GAGATAAAGAAGGCCCAGGAAGG + Intergenic
1152496727 17:80678266-80678288 GAAAGGAAGAAGAATCAGCAGGG + Intronic
1152629159 17:81402053-81402075 GGGATCAAGAAGAAGCAGGGAGG - Intronic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153427418 18:4981541-4981563 GAGAGCGAGAAAAAACAGGATGG + Intergenic
1153504508 18:5782027-5782049 GAGCCCAAGAAGAATCTAGATGG - Intergenic
1154279879 18:12993162-12993184 GAGAGCAGGAGGGATCAGGATGG + Intronic
1154517102 18:15183393-15183415 GAAATAATAAAGAATCAGGAAGG + Intergenic
1155071610 18:22321709-22321731 GAGACCCGGAAGAATCATGAAGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155937391 18:31767839-31767861 GAGGCCAAGAAGAATCTAGACGG + Intergenic
1156002553 18:32401495-32401517 GAGATCAAGAAAAATGTGAAAGG + Intronic
1156322763 18:36043181-36043203 AAGATCAAGAAGAATCGGGGGGG + Intronic
1156701787 18:39834812-39834834 GAGGCCAAGAAGAATCTAGATGG + Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1156959744 18:43011208-43011230 GTGATCAAGGAGGAGCAGGAAGG + Intronic
1157187215 18:45550958-45550980 GAGGGCTAGAATAATCAGGAAGG + Intronic
1158873107 18:61708002-61708024 GTGATCAAGAAGCACTAGGATGG + Intergenic
1159601399 18:70431578-70431600 GAGAATAAGAAGAATCAAGTTGG + Intergenic
1161424071 19:4192632-4192654 GAGATCAAGAGGAAACAAGCTGG + Intronic
1164265380 19:23610925-23610947 GAGAACAAGAAAAAGCAGGGTGG - Intronic
1167682289 19:50931185-50931207 GAGAGCAAGAGGATTGAGGAAGG - Intergenic
1167918787 19:52764124-52764146 GAAATGAAGAGGAATCAGAAAGG + Intergenic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926185557 2:10687982-10688004 GACATGGAGAAGAATCAAGAAGG - Intronic
928786614 2:34894695-34894717 GGGATCTATAAGAATCAGAATGG - Intergenic
929129159 2:38549275-38549297 GGGAGCAAGAAGAATGAGGGTGG + Intergenic
929457940 2:42079299-42079321 GAAGGCAAGAAGAATCAAGATGG - Intergenic
930278181 2:49338310-49338332 TAGAACAAGAAGAATCAGTAGGG + Intergenic
930455822 2:51606084-51606106 GAGAGCAAGGAAAATCAGGGTGG - Intergenic
931061448 2:58534007-58534029 GAGATCAGGAAGAATGAGCTTGG + Intergenic
931068729 2:58619890-58619912 AAAATCATGAAGAATGAGGAAGG - Intergenic
931852956 2:66271665-66271687 GAGAGAAAGGAGAAACAGGAGGG + Intergenic
932196312 2:69787019-69787041 GATATAAAGAAGAAACAGGCCGG - Intronic
932415900 2:71573795-71573817 AAGAAAAAGAAAAATCAGGAGGG - Intronic
932740395 2:74286531-74286553 GAGATGAAGAAAAGTAAGGAAGG - Intronic
933146172 2:78855799-78855821 GACAACAAGAAAAACCAGGAAGG + Intergenic
934091333 2:88553179-88553201 AACATGAAGAAGAATCAGAAAGG + Intergenic
934684694 2:96312219-96312241 GAGAAAAAGAAGAAGCATGAAGG + Intergenic
935815787 2:106844538-106844560 GAGAACAGGAAGAATCAGATAGG - Intronic
936412137 2:112269507-112269529 CAGATGAAGAAAAATCAGCAAGG + Intergenic
937482918 2:122281434-122281456 GAGCACAAGAAGAACCTGGAAGG + Intergenic
937530237 2:122819322-122819344 GACATGAAGAAGCATCAGGGAGG + Intergenic
938301657 2:130218669-130218691 GAGAGCCAGAACAATCTGGATGG + Intergenic
939319744 2:140603527-140603549 GAGAAGATGTAGAATCAGGATGG - Intronic
939584337 2:143988348-143988370 GTGATCACCAAGAATCAGGCAGG + Intronic
940238494 2:151536884-151536906 GAGTTCTAGAAGAATCATGAGGG + Intronic
940369270 2:152881901-152881923 GAGAAAAAGAAGAATCTTGAAGG - Intergenic
940509129 2:154590420-154590442 GAGATCAAGCACATTCAGGGTGG - Intergenic
940816325 2:158301762-158301784 GAGGTCCAGGAGGATCAGGATGG + Intronic
941416827 2:165231478-165231500 GAGGTTAAGAAGACCCAGGATGG + Intergenic
941510157 2:166397447-166397469 GAGATCATGGAGCATCAGGAAGG + Intergenic
941681450 2:168403762-168403784 GAGATCAGGCAGAAACTGGAGGG + Intergenic
942308208 2:174629252-174629274 AAGATCCTGATGAATCAGGAAGG - Intronic
942484432 2:176424306-176424328 GAGTTCAAAAAGATTCAGAATGG + Intergenic
943953865 2:194161848-194161870 AAGATCAAGGGGAAGCAGGAGGG - Intergenic
944820644 2:203427248-203427270 GTCATCAAGAAGAATGACGATGG + Exonic
945076479 2:206044602-206044624 GAGATAAAGAAAAATGAGGATGG + Intronic
947292591 2:228593590-228593612 GAGAGCAAGAAGGCACAGGAAGG + Intergenic
947507037 2:230715614-230715636 GACATCACGAAGACTCAGGCTGG + Intronic
1170051496 20:12150538-12150560 GAGAAGAAGGAGAATCAGTAGGG + Intergenic
1170842842 20:19938125-19938147 GAGATAAAGAAGAACCAGCCAGG - Intronic
1172999386 20:39094516-39094538 GAGCTGAAGAAGATTCTGGAAGG + Intergenic
1173397367 20:42691888-42691910 GAGAACATGAGGAAACAGGAAGG + Intronic
1175422073 20:58840854-58840876 GAAAACAAGGAGAATCTGGACGG - Intronic
1175703789 20:61160589-61160611 CAGGCCAAGATGAATCAGGAGGG - Intergenic
1175731687 20:61358515-61358537 GACATCAAAAATAATTAGGAGGG - Intronic
1176975156 21:15312562-15312584 GAAATGAAGAAGAATGAGCATGG + Intergenic
1178455054 21:32741535-32741557 GAGGCCAAGAAGAATCTGGACGG - Intronic
1179541016 21:42083326-42083348 GAGAAGAAGAAGCTTCAGGAAGG - Intronic
1180436417 22:15309127-15309149 GAAACCAAGAAGAATAAGGTAGG + Intergenic
1180520036 22:16189527-16189549 GAGATCACAAGGAAACAGGAAGG + Intergenic
1182024843 22:27110088-27110110 GATATCTACAAGAATCATGAAGG + Intergenic
1182574346 22:31262745-31262767 GACACCAAGGAGAATCTGGAGGG + Exonic
1183041840 22:35185788-35185810 AAGATCATCAAGATTCAGGATGG + Intergenic
1183195457 22:36350891-36350913 GAAATCAAGGAAGATCAGGAAGG + Intronic
1183380558 22:37488646-37488668 AAGATCAGGAAGATTCAGGCAGG + Intergenic
1183578747 22:38709675-38709697 GACACCAAGAAGAATCACGGAGG - Intronic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
950855584 3:16101620-16101642 GAAATCAAAATGAGTCAGGATGG + Intergenic
950948275 3:16973620-16973642 GTGATCAGGAAGAATCACCAGGG + Intronic
951865402 3:27301264-27301286 GAGCTCAAGAAGCATGGGGAAGG + Intronic
952022225 3:29037315-29037337 GAGAACTAGAAAAATCAGCAAGG - Intergenic
952170441 3:30800568-30800590 GAGTCCAAGATCAATCAGGAGGG - Intronic
952697902 3:36291526-36291548 AGGATCAGGAAGCATCAGGAAGG - Intergenic
952723881 3:36561616-36561638 GAGGTCTAGAAGAAGAAGGATGG - Intergenic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953621672 3:44538118-44538140 GAAATGAAGAAGCATGAGGAGGG + Intergenic
954108784 3:48422953-48422975 GGCAGCAAGAAGCATCAGGAAGG + Intronic
955505619 3:59630215-59630237 GAGATCAGAAAGAATCAGAAAGG - Intergenic
955641574 3:61091370-61091392 CAGATGAAGAAGACTTAGGAAGG - Intronic
955658607 3:61271864-61271886 AAGCTCAAGAAGAGGCAGGAAGG + Intergenic
957624250 3:82638951-82638973 GAGAGCATGAAGAAGCAGTATGG + Intergenic
958068119 3:88571901-88571923 GAGATAGAGAAGAATGATGAGGG + Intergenic
959860732 3:111212083-111212105 GAGAGCAGGAAGAATGGGGAAGG - Intronic
962288464 3:134108146-134108168 GCTATCAAGAACTATCAGGATGG + Intronic
963170071 3:142241502-142241524 GAGGTTAATAAGAAACAGGATGG + Intergenic
963264166 3:143222709-143222731 CAGATAAAGAGGAATCTGGAGGG - Intergenic
964666440 3:159179387-159179409 GAAATCAAGAAGAATCAGGGTGG - Intronic
964813461 3:160691372-160691394 GAGATCAAGAAGATACTGGGAGG - Intergenic
965030737 3:163363643-163363665 GGGAGCAAGAGAAATCAGGAGGG + Intergenic
965107796 3:164380338-164380360 GAGGCCAAGGAGAATCTGGAAGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965882838 3:173408454-173408476 GACTTCAAGGAGAGTCAGGAGGG - Intronic
966656476 3:182364296-182364318 GAGATCACGTGAAATCAGGAGGG - Intergenic
966740735 3:183231215-183231237 GGTATCAAGAAGAAACAGCAAGG + Intronic
966744160 3:183259835-183259857 GAGACCAAGAAGAAGAAGGAGGG + Intronic
967151248 3:186652742-186652764 GAGACCAAGAAGAGTCAAAAAGG - Exonic
970622080 4:17832767-17832789 GAGATGAAGAGGAACCAGTAGGG + Intronic
970740443 4:19231146-19231168 AAGATCAACAAGACTGAGGAAGG + Intergenic
973077018 4:45941454-45941476 GAGATCATGAAGAATGAGAGTGG - Intergenic
973143043 4:46792712-46792734 GAGAATCAGAAGAATTAGGATGG - Intronic
973786890 4:54340734-54340756 GAGATCAAACAGCATCAGAATGG + Intergenic
974499600 4:62683691-62683713 GAGATCAAGGAAAAGCAGGGTGG + Intergenic
974499943 4:62686218-62686240 AAGATCAAAAACAATAAGGAAGG + Intergenic
974970158 4:68813336-68813358 TACATCAAGTAGAATTAGGAAGG - Intergenic
975346607 4:73299485-73299507 GAGACCAAGAGGAATAAGGTAGG - Intergenic
976301874 4:83522996-83523018 GAGGCCAAGAAGAATCTGAATGG + Intronic
976488308 4:85636095-85636117 GAAATCAAGGAGAATAAGGCAGG - Intronic
976916882 4:90387116-90387138 GACATAAAGAAAAACCAGGAAGG + Intronic
977039729 4:92001637-92001659 GAGAGCAAGAAGAAGCAGGGTGG + Intergenic
977709954 4:100113497-100113519 GAGAAAAAGAACAACCAGGAAGG - Intergenic
977779148 4:100959893-100959915 CAGATCAAGAATATTCAGGAGGG - Intergenic
978227323 4:106352995-106353017 GACACCAAGAAGAATCTGGATGG - Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978978769 4:114915562-114915584 GTGTTAAAGAAAAATCAGGAAGG - Intronic
979022949 4:115525565-115525587 GAGAGCAAGTAGAAGCAGGGTGG - Intergenic
979738484 4:124119026-124119048 GAGATCAAAAACAAATAGGAAGG + Intergenic
980669448 4:135985778-135985800 GAGTACAAGAAGAATAAAGAGGG - Intergenic
980845601 4:138320660-138320682 GGGATCAAAAAGAATTTGGAAGG + Intergenic
981236235 4:142419044-142419066 GAGAAAAAGAAGAATCAAGAAGG + Intronic
981894566 4:149782916-149782938 GAGATGAAGAGGAAACAGCAAGG - Intergenic
982719942 4:158849020-158849042 GAGATCAAGAAGAATCAGGATGG - Intronic
983139311 4:164128922-164128944 GAGCTCAAGAAGAGTAAAGAGGG - Intronic
986615472 5:9613230-9613252 GAGATCAATAGGAGTGAGGAAGG + Intergenic
987466528 5:18278305-18278327 GAGATAAAGAAGATTTAGGGAGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987858879 5:23457894-23457916 GAGAGAAGGAAGAATCAGGTAGG - Intergenic
988522973 5:31962852-31962874 GTGATCTGGAAGAATCTGGAAGG - Intronic
988625448 5:32869992-32870014 GAGATCAGAAAGAATCACGGTGG + Intergenic
989682674 5:44047104-44047126 GAGAGCAAGGAAAAGCAGGATGG - Intergenic
989990451 5:50757866-50757888 AAGATCCAGAAGAATCCGTAAGG - Intronic
990290778 5:54349160-54349182 GGACTCATGAAGAATCAGGATGG + Intergenic
990417130 5:55597285-55597307 GAGATTAAAAAGAGTCAGGAAGG + Intergenic
990973657 5:61537742-61537764 GAGACCAAGAAGAGTCAGCTGGG - Intronic
992055213 5:72982205-72982227 GAGAGCGAGCAGAAGCAGGACGG - Intronic
993160052 5:84278799-84278821 GAGAACAGGAGGAGTCAGGATGG - Intronic
993437144 5:87911858-87911880 GGGATCAAGAAGAATTAAAATGG + Intergenic
993601336 5:89928683-89928705 GAAATCAAGAACAAGGAGGAAGG + Intergenic
994045168 5:95300520-95300542 GAGATCAATAAGAATATGAAGGG + Intergenic
995651419 5:114373235-114373257 AAGATCATGTAGAATTAGGAAGG - Intronic
996295113 5:121904310-121904332 GAGAGAAAAAAGAAACAGGAAGG - Intergenic
997062040 5:130518161-130518183 TAGACCAACAACAATCAGGAAGG - Intergenic
997126996 5:131237431-131237453 GATATAAAGAAAAATCAGAAAGG - Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997299067 5:132789218-132789240 GAGAGCAAGAACAATGGGGATGG - Intronic
997422423 5:133779920-133779942 GTGAGCAAGATGGATCAGGAGGG + Intergenic
998804200 5:145902684-145902706 GTGAGCAGGATGAATCAGGAAGG - Intergenic
999151000 5:149426064-149426086 GATTTCAATAAGAATCAGGGAGG - Intergenic
999594787 5:153190976-153190998 AAGATTAAGAAGAATGAGAAGGG - Intergenic
1000489710 5:161896075-161896097 GAGATAAAGGAGAGTCAGGAAGG + Intronic
1000505173 5:162107710-162107732 CAGATATAGAACAATCAGGAAGG - Intronic
1000743430 5:164998792-164998814 GAGATAAAGGAGAAGCAGGTGGG - Intergenic
1002508093 5:179694470-179694492 GAGAACAGGAAGAATCCAGATGG - Intronic
1003335493 6:5168032-5168054 AACATCAAAAAGAATAAGGATGG + Intronic
1003619766 6:7689339-7689361 GAGATCAGAAAGAAACAGTATGG - Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004944906 6:20601609-20601631 GAGATGAGCAAGAATCTGGAAGG + Intronic
1005102851 6:22191970-22191992 GAGATCAAGAGGAGTGAGAATGG + Intergenic
1006194883 6:32233661-32233683 GATATAAAGAAGAATCAGGCCGG - Intergenic
1006664537 6:35682674-35682696 GAGATGAAGAAAAATCAGACTGG - Intronic
1007468168 6:42069856-42069878 GAGATGAGGAAGAACCAGCATGG + Intronic
1007691280 6:43703058-43703080 GAGCTCAGGGAGACTCAGGATGG - Intergenic
1007812340 6:44495483-44495505 GAAATCAAGGAGGAGCAGGAAGG - Intergenic
1008082529 6:47209529-47209551 GAAAGCAAGAAAAAGCAGGATGG + Intergenic
1008742192 6:54623015-54623037 GAGATCAAGAAGAATCTGAATGG + Intergenic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1010311619 6:74392807-74392829 GAGATAGACAAGGATCAGGAAGG - Intergenic
1011882951 6:92053485-92053507 GAGAAGAAAAAGAAGCAGGAGGG + Intergenic
1012426410 6:99119781-99119803 AAGATCTAGAAGAAACAGAAGGG - Intergenic
1012922495 6:105234284-105234306 GAGAGCAAGCAGAAACAGGGTGG - Intergenic
1012958367 6:105595072-105595094 AAGATGGAGAAGAACCAGGAAGG + Intergenic
1013040413 6:106427357-106427379 GAGATAGGGAACAATCAGGAAGG - Intergenic
1013068112 6:106703285-106703307 GGGATGAGGAAGAAGCAGGATGG - Intergenic
1013105235 6:107021464-107021486 AAGATCCAGAAGAATGAGGGAGG - Intergenic
1014148771 6:118029119-118029141 CAGATGAAGAAGCTTCAGGAAGG + Intronic
1014352255 6:120359877-120359899 TAGATCAAGCAGAAGAAGGATGG + Intergenic
1015590608 6:134819331-134819353 GAGATGAAGAAAAATGAGGGGGG - Intergenic
1016500464 6:144714952-144714974 GAGAGAAGGAAGAACCAGGAAGG - Intronic
1016955956 6:149627089-149627111 GCTATCAAGAAGAATAAAGAAGG + Intronic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1019700061 7:2470479-2470501 GAGACCAAAAGGCATCAGGAGGG - Intergenic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1020607516 7:10357262-10357284 GAGATGCAGATGAACCAGGAAGG + Intergenic
1021428278 7:20529151-20529173 GAGACCAAGAGGAATGAGGTGGG - Intergenic
1022304116 7:29130159-29130181 GAGATCAGGAAGACTATGGAAGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023569596 7:41558268-41558290 GTGATCTAGAAGCATTAGGATGG - Intergenic
1025936218 7:66039809-66039831 GAGGCCAAGGAGAATCTGGATGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1028068559 7:86419669-86419691 GAATTCAAGAAGAAGAAGGAAGG + Intergenic
1028775498 7:94671493-94671515 TACATGAAGAAGAATCTGGAAGG + Intergenic
1029320897 7:99759007-99759029 GAGATCAAGAAGTGCCAGGTTGG + Intronic
1030272902 7:107688800-107688822 GAGATAGAGAAGAGTCAGCATGG + Intronic
1031509792 7:122635868-122635890 GAAACCAATAACAATCAGGAAGG - Intronic
1031897602 7:127369467-127369489 GAGCTCAAGTCAAATCAGGAAGG + Intronic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032001276 7:128267100-128267122 GACATCAAGTGGAATCAGGAGGG - Intergenic
1032296017 7:130639024-130639046 GAGGTCAAGTTGAAGCAGGATGG - Intronic
1032807504 7:135371660-135371682 GAGAACCAGAAGAATCTAGATGG + Intronic
1034177198 7:149109443-149109465 TAGAGAAAGAAGAATCAGTAGGG - Intronic
1034783641 7:153905054-153905076 GAGGCCAAGAAGAATCTAGATGG - Intronic
1034864789 7:154631845-154631867 AAGTTCAACAAGAAGCAGGAGGG + Intronic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1038252159 8:25915147-25915169 GAGATAAACAAGATTCAGAAAGG + Intronic
1038481263 8:27903194-27903216 GAGATCAAGCACACTCAGGATGG - Intronic
1038672448 8:29593186-29593208 GGGAGAAAGAACAATCAGGAAGG - Intergenic
1038812565 8:30864579-30864601 GAAATGAAGAAGAAATAGGAGGG + Intronic
1039776886 8:40745988-40746010 GAGATCTGGAAGAAACAGGCAGG - Intronic
1039897300 8:41725442-41725464 GAGATGAAGGAACATCAGGAAGG + Intronic
1040627356 8:49164244-49164266 GAGGTCAGGAAGACTCAAGAGGG - Intergenic
1040932932 8:52754152-52754174 GAGATTAATAAGAAACAGAATGG - Intergenic
1041755336 8:61307463-61307485 AAGATGAAGAAGTATGAGGAAGG + Intronic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1043309419 8:78839599-78839621 GAAATAAAGAAGAAAAAGGAAGG - Intergenic
1043956524 8:86366255-86366277 GAGATCAGCAAGATACAGGAAGG + Intronic
1044080861 8:87881573-87881595 GAAATCAATAAAAATCAGGGAGG + Intergenic
1044819014 8:96143608-96143630 GAAATCAATTAGAATCAGAAAGG + Exonic
1046003793 8:108453978-108454000 CAGAGCAAGAAAAATCAGTAGGG - Intronic
1046048058 8:108986856-108986878 GAGGGCAAGCAGAATCAGGGTGG - Intergenic
1047430724 8:124789434-124789456 GAAATGAAAAAGAAACAGGATGG - Intergenic
1048049829 8:130806442-130806464 CAGATCAAGATGATTCAGGAAGG + Intronic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048438539 8:134440935-134440957 GGGATCAAGAAGAATGAGTTTGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1051068547 9:13134887-13134909 GAGACTATGAAGAACCAGGAGGG - Intronic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051859802 9:21611585-21611607 GAGATGAAGAACAATCTGGGAGG + Intergenic
1051921954 9:22276887-22276909 TAGATCATGAATAATTAGGAGGG + Intergenic
1052182025 9:25541371-25541393 GAGATAAATAGGAAGCAGGAGGG - Intergenic
1052463536 9:28799157-28799179 GAAATCACTAAGAATCATGAAGG + Intergenic
1054907480 9:70423452-70423474 GAGATCAAGAGAGAACAGGAGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058961738 9:109998413-109998435 GAGGACGAGAATAATCAGGATGG + Intronic
1059370358 9:113825982-113826004 GAGATAAAGAAGAATCAAATGGG + Intergenic
1059971974 9:119677515-119677537 GAGACCCAGAGGCATCAGGAAGG + Intergenic
1060069836 9:120536411-120536433 GAGATGAAGAAGATGCACGAGGG - Exonic
1060937743 9:127525466-127525488 GGAATCAAGAATATTCAGGATGG + Intronic
1061523195 9:131134634-131134656 GAGAACACTAAGTATCAGGAAGG + Intronic
1061930598 9:133831104-133831126 GAGATCAGTCACAATCAGGACGG + Intronic
1062622472 9:137429085-137429107 GAGATGAAGAAGCTTCCGGAGGG + Intronic
1062702582 9:137915213-137915235 GAGAACAAGAGGAATCATGTGGG + Intronic
1187251389 X:17601306-17601328 GAAATCATGGAGAAGCAGGAAGG + Intronic
1187867740 X:23739507-23739529 AAGATCAAAAAGAACCAGGCTGG + Intronic
1189064013 X:37786766-37786788 AAGATCAGAAAGAAACAGGAAGG + Intronic
1189604714 X:42664510-42664532 GAGAGGAATAAGAAACAGGAAGG + Intergenic
1189679476 X:43500555-43500577 GAGATCCAGAAAACTGAGGAAGG + Intergenic
1190717128 X:53114345-53114367 AGGATCAAGAACAATCAGGGAGG - Intergenic
1190959850 X:55235116-55235138 GAGGGCAAGCAGAATCAGGGTGG - Intronic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1192890098 X:75381318-75381340 GAGGTAAAGAAGAATCAATAAGG - Intronic
1193037401 X:76966950-76966972 GAAGTCAAGAAGAAACGGGAAGG + Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193445501 X:81596874-81596896 GAGATAAATAATAACCAGGATGG + Intergenic
1193526276 X:82593436-82593458 GAGATCAAGAGAAGTCAAGAAGG - Intergenic
1194177145 X:90664990-90665012 GAGAGCAAGGAAAAGCAGGATGG + Intergenic
1194193411 X:90864786-90864808 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1194324037 X:92488879-92488901 GATATAAAGAAGTTTCAGGATGG + Intronic
1194624701 X:96214352-96214374 GAGGGCAAGATGAAGCAGGATGG + Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195862648 X:109398201-109398223 GACATCCAGAAGCATCATGAGGG + Intronic
1196084470 X:111669913-111669935 GAGATCAAGCACATTCAGGGTGG + Intronic
1196381708 X:115098372-115098394 GAGAGCAAGAAAAAGCAGGGTGG + Intergenic
1196895836 X:120334673-120334695 GACATCTAGAAAAATCAGGAAGG + Intergenic
1197063820 X:122215050-122215072 GAGGGAAAGAAGAAACAGGAAGG - Intergenic
1197319027 X:125005727-125005749 GAGAGCGAGCAGAAGCAGGATGG + Intergenic
1197799580 X:130335505-130335527 GAGATCAAGCAGAATCTAGAGGG + Intergenic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198878906 X:141257518-141257540 GAGATCAAGAAGAAATGGAAGGG + Intergenic
1199380726 X:147168928-147168950 GGGATCACGGAGTATCAGGAAGG - Intergenic
1199499963 X:148498268-148498290 GAGATCAAAACCAAGCAGGAAGG - Intergenic
1200540022 Y:4447173-4447195 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1200632140 Y:5601972-5601994 GATATAAAGAAGTTTCAGGATGG + Intronic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201794344 Y:17878678-17878700 GAGATCACAAAGAGGCAGGATGG + Exonic
1201807210 Y:18027307-18027329 GAGATCACAAAGAGGCAGGATGG - Exonic
1202340179 Y:23855893-23855915 GAGATCACGAAGAGGCAGTATGG + Intergenic
1202355724 Y:24046477-24046499 GAGATCACAAAGAGGCAGGATGG + Exonic
1202515054 Y:25623632-25623654 GAGATCACAAAGAGGCAGGATGG - Exonic
1202530587 Y:25814189-25814211 GAGATCACGAAGAGGCAGTATGG - Intergenic