ID: 982726709

View in Genome Browser
Species Human (GRCh38)
Location 4:158913951-158913973
Sequence AATTAACAACAGATGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982726709 Original CRISPR AATTAACAACAGATGGGGCT GGG Intronic
900988847 1:6088676-6088698 AATTAAGAACACATCAGGCTGGG - Intronic
901552404 1:10005356-10005378 AAATAAAAACAGCTGAGGCTGGG - Intronic
901707786 1:11089312-11089334 ATTTAAGAAAACATGGGGCTGGG + Intronic
903518925 1:23932625-23932647 ACTTTTCAACAAATGGGGCTGGG + Intergenic
903803457 1:25987434-25987456 AAATAAGAACACATGGGGCCGGG + Intronic
904164990 1:28548548-28548570 AATTAGCAAGAGGTGGGGCCGGG + Intergenic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905735512 1:40323002-40323024 AAATATTAACAGATTGGGCTGGG + Intergenic
906074845 1:43044447-43044469 AATTAAGCCCAGATGAGGCTGGG + Intergenic
906327453 1:44856217-44856239 AATTAAGAAAATCTGGGGCTGGG + Intronic
906387822 1:45386945-45386967 AAAAAACTACATATGGGGCTGGG - Intronic
907374891 1:54028512-54028534 GCATAACAAAAGATGGGGCTAGG - Intergenic
907496853 1:54851140-54851162 AATTAACTACAGCTGGGGTGGGG + Exonic
907572249 1:55493988-55494010 AACTAAAAAGAGATGTGGCTGGG + Intergenic
908199679 1:61781417-61781439 AATAAGCAACAAATGGGGCCAGG - Intronic
908387129 1:63653452-63653474 ATTAAACACCAGATGGGGATTGG + Intronic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
908953757 1:69595473-69595495 AGTTGATAACGGATGGGGCTGGG + Intronic
914740481 1:150460691-150460713 AATCAACAACAGACTGGGCACGG - Intronic
916327648 1:163581236-163581258 GATTAAAAACAAATGGGGGTTGG - Intergenic
918413772 1:184286875-184286897 AATTCCCCACAGATGGGGCTGGG - Intergenic
918972535 1:191438183-191438205 AAAAAACAACAAATGGTGCTGGG + Intergenic
921246834 1:213252223-213252245 AATTAGCAACAGATGCTGCAGGG + Intronic
921749507 1:218776262-218776284 AATAAGCAAAAGAAGGGGCTTGG - Intergenic
921806761 1:219463779-219463801 AATTAGCACCAGATGGGACAGGG + Intergenic
922149680 1:222988235-222988257 AATTAACTATAAATAGGGCTAGG + Intronic
922420337 1:225456141-225456163 AATTTTCAATAAATGGGGCTGGG + Intergenic
922778214 1:228227317-228227339 GATTAACATGAGATGGTGCTTGG + Intronic
923047496 1:230366319-230366341 GATTACCTGCAGATGGGGCTGGG + Intronic
923151538 1:231237885-231237907 AATTAAAAACATTTGGGGCCAGG + Intronic
923686650 1:236158126-236158148 ATTAAACCACAGCTGGGGCTGGG + Intronic
1062984647 10:1756869-1756891 AATTAAGAGCAGATAAGGCTGGG + Intergenic
1063278982 10:4603504-4603526 AATTCAGAGCAGATAGGGCTGGG - Intergenic
1065775991 10:29120822-29120844 AATTAACAACAAATGGTACTTGG - Intergenic
1065813761 10:29465640-29465662 AACTGACCACAGAGGGGGCTCGG + Exonic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1065957898 10:30709386-30709408 AACTGACCACAGAGGGGGCTCGG - Intergenic
1066715001 10:38277168-38277190 CAAAAACAATAGATGGGGCTGGG + Intergenic
1066783079 10:38973532-38973554 CAAAAACAATAGATGGGGCTGGG - Intergenic
1067243575 10:44517338-44517360 ACTTAAGAACAGATGGGGACGGG - Intergenic
1067732923 10:48825604-48825626 AAGAAACAACAGATGGGGTGAGG - Intronic
1069177776 10:65315005-65315027 AATTAATAAGAGATGTGTCTGGG + Intergenic
1069302823 10:66928988-66929010 AACTATCAAAAGATGGTGCTAGG + Intronic
1070350892 10:75591352-75591374 AGTTAAAAACAGATGGGGCAAGG + Intronic
1072990930 10:100192746-100192768 AATTAATAAAATATAGGGCTTGG + Intronic
1073361236 10:102900786-102900808 AAGAAACAACAAATGGGGCCGGG + Exonic
1073433237 10:103500394-103500416 AGTTAGAAACTGATGGGGCTGGG + Intronic
1073479932 10:103780000-103780022 AATCAAGAACAATTGGGGCTAGG - Intronic
1077113874 11:874164-874186 GATTAAAAACAGAGGGGGCCGGG + Intronic
1077637469 11:3853675-3853697 CATTAAGAGAAGATGGGGCTGGG - Intergenic
1078224606 11:9380489-9380511 AATTAAGAAGAGATGCGGCCGGG - Intergenic
1079215196 11:18503665-18503687 AATTAAGAATAGTTAGGGCTGGG - Intronic
1080157645 11:29130720-29130742 AAGTAGCAAGAGATGAGGCTGGG + Intergenic
1080604314 11:33852248-33852270 TATTAACAACAGGTGAGTCTAGG - Intergenic
1081236307 11:40651335-40651357 AATTAAAAAGAGATGGGGGTGGG + Intronic
1081649014 11:44810897-44810919 AATTGAAAACAGGTTGGGCTTGG - Intronic
1081698555 11:45136844-45136866 AATCAAAAACAGATGGGGGCCGG + Intronic
1082061401 11:47863749-47863771 AGTTAATAAAAGATGGGACTAGG - Intergenic
1082083596 11:48031151-48031173 AAATAACAAAAGATGAGGCTAGG - Intronic
1084961535 11:72719395-72719417 AATTAACTAGAGACAGGGCTTGG + Intronic
1085605607 11:77895447-77895469 AATGAACAAAAAATGGGGCCGGG + Intronic
1087878064 11:103381735-103381757 AATTAATAAAAGATTGGGCATGG - Intronic
1090526020 11:127537757-127537779 ATTTAACAAAAGATGAGGTTAGG + Intergenic
1091736306 12:2924880-2924902 AATTAAAAAAAAATAGGGCTGGG + Intronic
1093914084 12:24781212-24781234 CATGAACAATAGATGGTGCTAGG - Intergenic
1094422605 12:30287307-30287329 TATTTTCAACAGATGGTGCTGGG - Intergenic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1094699625 12:32856372-32856394 GATTAACAGAAGATGGTGCTGGG + Intronic
1097638549 12:62150922-62150944 ACTTATCAATGGATGGGGCTGGG + Intronic
1097653268 12:62330291-62330313 AAAAAAAAACAAATGGGGCTGGG + Intronic
1098862736 12:75728164-75728186 AAATAAAATCATATGGGGCTGGG + Intergenic
1099554085 12:84088094-84088116 TATTTTCAACAGATGGTGCTGGG - Intergenic
1100182892 12:92104701-92104723 AATTAATAACAGATGTAGGTGGG + Intronic
1101824147 12:108207680-108207702 AATCAAGAACAGCAGGGGCTGGG - Intronic
1102359521 12:112272343-112272365 AATTAAAAATAAATGAGGCTAGG - Intronic
1102451890 12:113048114-113048136 AATTAAGATCATAAGGGGCTGGG - Intergenic
1103584119 12:121938300-121938322 CAACAACAACAGATGAGGCTGGG - Intronic
1104451214 12:128869463-128869485 ATTTCAAAATAGATGGGGCTGGG - Intronic
1105524515 13:21164057-21164079 AATTAACAAAAGAAGAGGCCGGG - Intronic
1105580472 13:21691288-21691310 AATTATAAACAAAAGGGGCTTGG + Intronic
1105871533 13:24509993-24510015 AAATATCAACAGTGGGGGCTAGG - Intronic
1107830184 13:44368189-44368211 TATTAATAACAGATGTGGCCAGG + Intergenic
1108459445 13:50650552-50650574 AATGAAAAACAGATTGGGGTTGG + Intronic
1108484090 13:50907260-50907282 AAGAAACAACAGATGAGGCCGGG - Intergenic
1108577398 13:51802057-51802079 TATTAACAACAGATCGGACCAGG - Intronic
1108758999 13:53539968-53539990 AATTAACTAAAACTGGGGCTGGG + Intergenic
1110215539 13:73020948-73020970 AGTTAACAAGAGAAGGGTCTTGG - Intergenic
1110880494 13:80566456-80566478 ACTTAACTACAGGTGGGGCTGGG - Intergenic
1111674846 13:91374758-91374780 AATTAGCAACAGCGGGGGGTGGG + Intergenic
1112119919 13:96398572-96398594 AAAATGCAACAGATGGGGCTGGG - Intronic
1113452728 13:110423076-110423098 ATTTCACAGCAAATGGGGCTTGG + Intronic
1114458115 14:22870256-22870278 TATTCAAAACAGATGCGGCTGGG + Intergenic
1115231738 14:31167820-31167842 ATTTAACAACTAATTGGGCTGGG - Intronic
1115425498 14:33254235-33254257 AAATCCTAACAGATGGGGCTGGG - Intronic
1116148623 14:41107917-41107939 AAAAAACAACAGATGGTGGTAGG + Intergenic
1116436852 14:44904756-44904778 AACTTATAAAAGATGGGGCTAGG - Intronic
1116645760 14:47526918-47526940 AACTCAAAGCAGATGGGGCTTGG - Intronic
1116751093 14:48884911-48884933 TATTTTCAACAGATGGTGCTAGG - Intergenic
1116812859 14:49556056-49556078 ATTTAAAAAAAAATGGGGCTGGG - Intergenic
1117152355 14:52902442-52902464 TATTAACAACAGAGGGGGAAGGG + Intronic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1118489521 14:66245475-66245497 GATTATCAACAGAAGGTGCTGGG + Intergenic
1118920232 14:70143435-70143457 ATTTACAAACAGATGGGCCTGGG + Intronic
1121113106 14:91325863-91325885 CATTGAAAACAGATTGGGCTCGG - Intronic
1121275612 14:92665731-92665753 CATTAAGAAAAGGTGGGGCTGGG - Intronic
1121411244 14:93749745-93749767 AATTAACAGGTGATGAGGCTGGG + Intronic
1121636139 14:95455094-95455116 AAATAACAGCAGAGGGGGATTGG - Intronic
1122656820 14:103267616-103267638 ATTTAACATGAGATGTGGCTGGG + Intergenic
1123930260 15:25166067-25166089 CATAATCAATAGATGGGGCTTGG - Intergenic
1124007636 15:25807505-25807527 AAAGAAAAACACATGGGGCTGGG + Intronic
1124093771 15:26629708-26629730 AATTACAACCAGAAGGGGCTCGG - Intronic
1124723468 15:32133686-32133708 AATTCACAACAGATGAGGGAAGG + Intronic
1124871724 15:33550169-33550191 CAGTAACATCAGATGGGGCCAGG + Exonic
1125529605 15:40404179-40404201 AATTAATTAGAGATGGGGCCGGG - Intergenic
1125858137 15:42971008-42971030 GATTAAAAACAGGTGGGGCTGGG - Intronic
1125881210 15:43197685-43197707 AAGGAACAACAGATGTAGCTTGG - Intronic
1126444312 15:48725251-48725273 CATTAACAACAGAGGAGTCTGGG + Intronic
1126981046 15:54243217-54243239 AAGTGAGAACATATGGGGCTTGG + Intronic
1127098413 15:55536229-55536251 AATTAAGAAATGAAGGGGCTAGG - Intergenic
1127502360 15:59566280-59566302 AATTAAGAACTTATGGGGCCAGG - Intergenic
1128473366 15:67975364-67975386 AAAAAACAACAGGTTGGGCTGGG + Intergenic
1129553188 15:76475601-76475623 AATTAAAAGCTGATGGGGCATGG - Intronic
1129784515 15:78300297-78300319 AAAAAAAAAGAGATGGGGCTGGG + Intergenic
1129834053 15:78690905-78690927 AATTAAGAACAACTAGGGCTGGG + Intronic
1131338330 15:91571886-91571908 TATTAAAAACAGGTGGGGCCAGG - Intergenic
1131396130 15:92087812-92087834 AGATAATAATAGATGGGGCTGGG - Intronic
1131726211 15:95228100-95228122 GCTTAACAGCAGATGGGGGTGGG - Intergenic
1132754954 16:1479340-1479362 AAATAACAAAATATTGGGCTGGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136734529 16:32452749-32452771 AATAAGAAACACATGGGGCTAGG - Intergenic
1137032647 16:35538318-35538340 AAAGAAAAACAGATGAGGCTGGG + Intergenic
1137570107 16:49559673-49559695 AATGCACAAAAGATGGAGCTTGG - Intronic
1137594421 16:49714359-49714381 AATTAAAAACTGATGGGGCCAGG + Intronic
1138306831 16:55984957-55984979 AAAAAATAACAGATGCGGCTGGG - Intergenic
1139324069 16:66138241-66138263 AAATAACAGCAGAGAGGGCTGGG + Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140769549 16:78190891-78190913 AAAAAACAACAAATGGGGATTGG - Intronic
1142391765 16:89805806-89805828 AATAAACAACAGAAGGGAATTGG - Intronic
1203018550 16_KI270728v1_random:376853-376875 AATAAGAAACACATGGGGCTAGG + Intergenic
1203036885 16_KI270728v1_random:650011-650033 AATAAGAAACACATGGGGCTAGG + Intergenic
1142576318 17:910729-910751 AATCAAGGACAGATGGGACTGGG - Exonic
1142580453 17:938762-938784 AATTAAGAACAGAACAGGCTGGG + Intronic
1142823488 17:2491914-2491936 AAATAAAAACAAATAGGGCTGGG + Intronic
1142830074 17:2542207-2542229 ATTGAACTTCAGATGGGGCTGGG + Intergenic
1146860995 17:36298337-36298359 AATTAATAGAAGATGGAGCTAGG - Intronic
1147091326 17:38102441-38102463 AATTAATAGAAGATGGAGCTAGG - Intergenic
1147105886 17:38218064-38218086 AATTAATAGAAGATGGAGCTAGG + Intergenic
1147489782 17:40855136-40855158 AATTAAGAAAAACTGGGGCTGGG - Intergenic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1148691714 17:49531480-49531502 AATTAAAAATAAATGAGGCTGGG - Intergenic
1149202788 17:54207420-54207442 AAAAAATAACAGATGCGGCTGGG + Intergenic
1150038189 17:61827431-61827453 AATTTAAAAAAAATGGGGCTGGG + Intronic
1150343928 17:64389617-64389639 AAATAAAAACAGTTGGGGATAGG + Intronic
1150869614 17:68892107-68892129 GAGTAACAACAGATGGAACTAGG - Intronic
1150914541 17:69423181-69423203 ACTTAAAAACAGCTGAGGCTTGG - Intronic
1152734039 17:81988163-81988185 AAGAAACAACAGAAGTGGCTGGG + Intronic
1153234926 18:2976909-2976931 AATCACAAACAGCTGGGGCTGGG + Intronic
1153379955 18:4427325-4427347 AATAAACAAAGGATGGGACTTGG + Intronic
1153828766 18:8901052-8901074 AAATACCATCAGATGGGGCAGGG - Intergenic
1155298860 18:24410406-24410428 AAGTAACAATAGACAGGGCTTGG + Intergenic
1158200488 18:54933374-54933396 AATTAACAAAAGAACAGGCTGGG - Intronic
1160423334 18:78764369-78764391 AATTCACAACCGTTGGGGCTAGG + Intergenic
1160915203 19:1493097-1493119 GATTAGCAGCAGATGGGACTGGG - Intronic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1162706405 19:12558310-12558332 TTTTAAAAACTGATGGGGCTGGG + Intronic
1163678038 19:18665349-18665371 AAGTAAAGACAGATTGGGCTGGG - Intronic
1166611896 19:44205623-44205645 AACAAACAAAATATGGGGCTGGG + Intergenic
1166752499 19:45171004-45171026 TCTTAAAAACAGAAGGGGCTGGG + Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167209006 19:48121504-48121526 AAATAAGAACAAATGGGGCCGGG + Intronic
1167646336 19:50707365-50707387 AATTAGCATCAGAGGGCGCTGGG - Intronic
1168561302 19:57385974-57385996 AATTAAGAATAAATGGGGCCAGG + Intronic
925707026 2:6695584-6695606 ATTTAACAATAGATGGGATTAGG + Intergenic
929145046 2:38699207-38699229 AAATAATAACAGCTGGGGCCAGG - Intronic
929153010 2:38764785-38764807 AATGAACTCCAGAAGGGGCTGGG - Intronic
929636802 2:43531287-43531309 AATTAACATGAGAAGAGGCTGGG + Intronic
930496998 2:52158089-52158111 AATCAACAACTGATAGGACTTGG + Intergenic
934048450 2:88190720-88190742 AATTAAGAAAAGATGTGGCTGGG + Intergenic
937094427 2:119226182-119226204 AATGAACAACTGAGAGGGCTGGG + Intronic
939234922 2:139478706-139478728 AATGACCAGTAGATGGGGCTCGG + Intergenic
942495753 2:176538499-176538521 AATTAAAAGAAGGTGGGGCTGGG + Intergenic
942666580 2:178325830-178325852 AGCTCACAGCAGATGGGGCTTGG + Intronic
943607554 2:189994305-189994327 AAATAACAAAAGATCAGGCTGGG - Intronic
945034293 2:205690960-205690982 ACTTAATAACAGCTGGGGGTGGG + Intronic
947773786 2:232691619-232691641 AATAAAAAAGAGAGGGGGCTGGG + Intergenic
948147698 2:235720416-235720438 AAGTAACCACAGGTGAGGCTGGG - Intronic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948558990 2:238838015-238838037 AATTAAAAATACATGTGGCTGGG - Intergenic
1169057673 20:2636904-2636926 GATTAACAGAAGAAGGGGCTGGG - Intronic
1172473477 20:35219025-35219047 GATAAAAAACTGATGGGGCTGGG - Intergenic
1173846530 20:46192096-46192118 AAATAAAAACAGAGGGTGCTGGG - Intronic
1174047303 20:47742493-47742515 AAATCCCAACAGATGGGCCTGGG - Intronic
1174843511 20:53921508-53921530 AAGCAACAACAGCTGGAGCTGGG + Intergenic
1175018801 20:55822282-55822304 AATAAAGAAGAGTTGGGGCTGGG + Intergenic
1176177133 20:63734026-63734048 AATGACCAACTGATGGGGCCTGG + Intronic
1177386620 21:20417855-20417877 CATTCAAAACAAATGGGGCTGGG + Intergenic
1179604908 21:42508589-42508611 AATTTACAACAGATGGGCTCAGG + Intronic
1179677916 21:42997174-42997196 AATAAACAGCATATGGGGCCAGG - Intronic
1181526337 22:23490844-23490866 AATATACAAAAGATAGGGCTGGG - Intergenic
1182341616 22:29626445-29626467 AAATATCTGCAGATGGGGCTGGG - Intronic
1183938152 22:41276340-41276362 AATTAAAAACAAAATGGGCTGGG + Intronic
1184495225 22:44837178-44837200 AATTAAAAACAGTAGGGGCTGGG - Intronic
1184525911 22:45022503-45022525 AAGAAACAACAGATGTGGCTGGG - Intergenic
949249839 3:1970539-1970561 AATTAAAATCAAATGAGGCTGGG - Intergenic
950162462 3:10770895-10770917 AATTAATAAACGATGGTGCTTGG - Intergenic
950795786 3:15509875-15509897 GAATAAGAGCAGATGGGGCTGGG + Intronic
951194774 3:19812005-19812027 ATATAAAAACTGATGGGGCTGGG - Intergenic
953756733 3:45653073-45653095 TAATAACTACAGTTGGGGCTTGG + Intronic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
955366422 3:58314058-58314080 AAATAATAACACATGGGGCGTGG + Intronic
955759773 3:62266845-62266867 AATGAACAAAAGTTGGGGGTAGG - Intronic
956421751 3:69093121-69093143 AATAAACAACAGGTTGGACTCGG - Intronic
956567536 3:70655944-70655966 AATCAATAACAGATGGAGTTAGG + Intergenic
958059322 3:88458444-88458466 AATTAAAAACAAAGAGGGCTGGG - Intergenic
958796134 3:98708398-98708420 ATTAAAAAACACATGGGGCTAGG + Intergenic
959761392 3:109969800-109969822 AATAAGCAAGAGATGGGGCCAGG - Intergenic
962529990 3:136270479-136270501 AAAAAACAACAGATGTGGCCGGG - Intronic
962993469 3:140601700-140601722 AAATAATGACAGATGGGGCAGGG - Intergenic
964031736 3:152146541-152146563 AATAAACTAAAGATGGGGCCAGG - Intergenic
965069242 3:163896153-163896175 AATTAACAACATTTGGGGGTGGG + Intergenic
965887223 3:173461342-173461364 AAATAAAAACAAATGGGTCTGGG - Intronic
967521661 3:190439377-190439399 AATTTACAATAGATGGAGCAGGG - Intronic
967558592 3:190891013-190891035 AAGAAACAACTGATGTGGCTTGG - Intronic
968072347 3:195793200-195793222 AAATAATAAGAGATGGGGCCGGG + Intronic
969550218 4:7860992-7861014 ACTAAGCAACAGATGGGGCAGGG - Intronic
971057370 4:22928723-22928745 AAATAACAAGAGATTGGACTGGG - Intergenic
971759055 4:30740939-30740961 AATTAACTTCAGATGGGCTTTGG - Intronic
972292403 4:37701890-37701912 CATTAAAAGCACATGGGGCTGGG - Intergenic
973113395 4:46423972-46423994 AATTAAAAACAGATAGTGCAGGG - Intronic
974081864 4:57222115-57222137 AAATAACTGCTGATGGGGCTAGG - Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
975430900 4:74289660-74289682 AAGTAAGAACTGATGGGGCGTGG + Intronic
975632636 4:76418243-76418265 CATTAAAAGCAGATGGTGCTGGG + Intronic
976187794 4:82459564-82459586 AATTAAAATGATATGGGGCTGGG - Intronic
976817882 4:89171889-89171911 AATTAACAACAGATACCCCTAGG + Intergenic
976821376 4:89211085-89211107 AATAAACAACAGATGAGGCTGGG + Intergenic
977762769 4:100759234-100759256 AATTACCATCAGGTGGGGCCAGG - Intronic
979110647 4:116750565-116750587 AATTACTAACAGATGGGGGTTGG - Intergenic
980037288 4:127899749-127899771 CAATAAGAACACATGGGGCTGGG - Intergenic
981392464 4:144207658-144207680 AATTATCAGCAAAAGGGGCTGGG - Intergenic
981675433 4:147338217-147338239 AAAGAACAAGAGAAGGGGCTGGG + Intergenic
982095883 4:151923053-151923075 AATTAAAAGCAGATGCTGCTGGG + Intergenic
982515302 4:156339287-156339309 AATTAACAGCTGATGGGTATGGG - Intergenic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
984279889 4:177657961-177657983 AATTTACAACTGATGTGGTTTGG + Intergenic
987079691 5:14415510-14415532 AACTAACAAGAGCTGTGGCTGGG - Intronic
987955774 5:24738024-24738046 AAGCAACAACAAATGAGGCTGGG + Intergenic
988235866 5:28543297-28543319 AATGAACAACAGATTGGTCGGGG + Intergenic
988504323 5:31808679-31808701 AAATAACAACTAATGAGGCTGGG + Intronic
988820074 5:34874560-34874582 ATTTAACAACAAAAGGAGCTGGG + Intronic
989559045 5:42830019-42830041 CTTTAACAGCAGAAGGGGCTGGG - Intronic
989584509 5:43064146-43064168 ATTTAAAAGCTGATGGGGCTAGG - Intergenic
989781111 5:45265715-45265737 AACTCAAAAAAGATGGGGCTGGG - Intronic
989798078 5:45499874-45499896 AATTATCAACAGAGTAGGCTGGG - Intronic
990247019 5:53873313-53873335 AAATAAAAACAGATGAGGCTGGG - Intergenic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
995590811 5:113698251-113698273 ATTTAACAAATGATGTGGCTTGG + Intergenic
998073743 5:139219356-139219378 CATTAAAATCACATGGGGCTAGG + Intronic
998108967 5:139486609-139486631 AGTTAACTACAGATGTGGCAGGG + Intergenic
999998929 5:157119506-157119528 AATTTCCAATAAATGGGGCTGGG - Intronic
1003537932 6:6992046-6992068 AATGAACTACAACTGGGGCTGGG + Intergenic
1003761048 6:9179225-9179247 TATTAACAACAGATCTGGATCGG - Intergenic
1005625227 6:27656149-27656171 AATAGTCAAAAGATGGGGCTGGG + Intergenic
1005991047 6:30902349-30902371 AATTAACTGCAGGTGGGGCTGGG - Intergenic
1008547595 6:52597089-52597111 AGCTAGCAACAGATGGAGCTAGG - Intergenic
1008628429 6:53340954-53340976 AAATCAAACCAGATGGGGCTAGG + Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1008743902 6:54645200-54645222 AATTAAAAATAGAAGGGGTTGGG - Intergenic
1008797846 6:55326599-55326621 AATTAAGAAGAGATAGGGATGGG - Intergenic
1008901369 6:56621002-56621024 AATTTACAACAGATGAGGAAAGG + Intronic
1009456587 6:63863967-63863989 AATTAACAAAAGTGGTGGCTAGG - Intronic
1010198663 6:73263901-73263923 TATTAACAAAAGGTCGGGCTGGG + Intronic
1010956287 6:82094275-82094297 ACTTAAAGAGAGATGGGGCTTGG + Intergenic
1011695053 6:89904866-89904888 AATTAATAATAGCTGGGGCCAGG - Intergenic
1013751703 6:113414687-113414709 AATTACCAACAGAGGGAGCCTGG + Intergenic
1015809870 6:137151319-137151341 AATTTTCAACAAATGGTGCTGGG + Intronic
1016003429 6:139066162-139066184 AAGTAAAGACAGCTGGGGCTTGG + Intergenic
1016091182 6:139981089-139981111 AACTACCAACAAAAGGGGCTTGG + Intergenic
1016159587 6:140861885-140861907 AATTAAAAAAAAATGGGGATGGG - Intergenic
1016829852 6:148423230-148423252 ATTAAAAAACACATGGGGCTGGG - Intronic
1016960089 6:149665061-149665083 AAATAACAAAGCATGGGGCTGGG + Intronic
1017959111 6:159206566-159206588 TGTTGACAACAGCTGGGGCTTGG + Intronic
1018703021 6:166442214-166442236 TATTCAGAGCAGATGGGGCTGGG - Intronic
1019667663 7:2259839-2259861 ACTGAACCACAGATGGGACTTGG - Intronic
1020427804 7:8089863-8089885 AGTCAAGAAGAGATGGGGCTAGG - Intronic
1023760095 7:43457475-43457497 TATTAAAAACACATGGGGCCGGG + Intronic
1024218531 7:47268302-47268324 AATCAGTAACAGATGTGGCTTGG - Intergenic
1024856570 7:53788149-53788171 AATAAAGAAAAGGTGGGGCTGGG + Intergenic
1025846997 7:65208633-65208655 AATGAACAAAAAATGGGGCCGGG - Intergenic
1026221020 7:68397757-68397779 TAATAACAACAGAGAGGGCTGGG + Intergenic
1026259227 7:68739933-68739955 AATCAACAATAGATCGGGCGTGG + Intergenic
1028922440 7:96322413-96322435 AAGTAACGACAGATGGTGCACGG + Intergenic
1029447472 7:100621885-100621907 AACAAACCAGAGATGGGGCTAGG - Intronic
1032450462 7:132026018-132026040 AATTTTCAGCAGAGGGGGCTGGG + Intergenic
1033579759 7:142721387-142721409 AATTTACAACACATCGGACTGGG - Intergenic
1034156687 7:148961428-148961450 TTTTAACAAGAGATGTGGCTGGG + Intergenic
1035594680 8:847089-847111 CATTAAAAACACATGGGCCTGGG + Intergenic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1039483418 8:37892731-37892753 AATTAAAAGCAGTGGGGGCTGGG - Intronic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1041471925 8:58220182-58220204 AATAAACAACAAATGAGGTTGGG + Intergenic
1041735331 8:61105123-61105145 AAATTAAAACAGATGTGGCTGGG - Intronic
1041769620 8:61458692-61458714 AACTGAAAACAAATGGGGCTTGG + Intronic
1042342179 8:67692039-67692061 AAAGAACAAGAGATTGGGCTGGG + Intronic
1042767962 8:72347102-72347124 AATTGCAAAAAGATGGGGCTGGG - Intergenic
1044591940 8:93921707-93921729 AATGTACAACAGATTTGGCTGGG - Intronic
1044789913 8:95836737-95836759 AATTAACAAGAAATGGAGCTAGG + Intergenic
1045956198 8:107910765-107910787 AATTAAAAACAGGTTGGGCATGG + Intronic
1046448698 8:114359057-114359079 AAATACCATCAGATGGGGGTAGG - Intergenic
1046868230 8:119174706-119174728 AAATAAAAACAGGTGGGGCACGG - Intronic
1047263890 8:123287340-123287362 GGTTAAAAACAGATGGGGCCGGG - Intergenic
1047570705 8:126095618-126095640 ATTTAAAAACTGATGGGGCCAGG + Intergenic
1048017959 8:130514238-130514260 TATTAATAACAGATGAGCCTGGG + Intergenic
1049548179 8:143244494-143244516 AATTGATGACTGATGGGGCTGGG - Intergenic
1050156873 9:2676641-2676663 CATTAACAAACGGTGGGGCTTGG + Intergenic
1051275295 9:15392673-15392695 AATGAACAACTGGTAGGGCTGGG + Intergenic
1051445648 9:17135952-17135974 ACTTAACAATAGATGATGCTTGG + Intronic
1052182880 9:25552215-25552237 ATTTAACATTAGATGGGGATAGG - Intergenic
1052444623 9:28544459-28544481 AATCAACAACAGAGAGGGTTCGG - Intronic
1055334985 9:75224290-75224312 AATTAAAAAGAGTTGAGGCTTGG - Intergenic
1055421463 9:76147851-76147873 AAAAAAGAACAGATGTGGCTGGG - Intronic
1055938006 9:81621580-81621602 AATTTAAAATAGAAGGGGCTGGG + Intronic
1056517511 9:87369247-87369269 AATTAAAAACATATTTGGCTGGG - Intergenic
1056920266 9:90781319-90781341 AATGAAAGACAGATGGGGCCCGG + Intergenic
1057372168 9:94484019-94484041 AATTAAGAGAAGATGGGGCCGGG + Intergenic
1058461046 9:105183074-105183096 AAAAAACAACAGATGGGGAGAGG - Intergenic
1058963705 9:110016745-110016767 AGTTAACAAAGGATGGGGGTGGG + Intronic
1059325024 9:113498766-113498788 AATTAACTAGACATGGTGCTGGG + Intronic
1059642089 9:116227360-116227382 AATGAGCAACTGATGGGACTAGG - Intronic
1059821273 9:117975144-117975166 AATTAACACAAGATGGTGTTTGG - Intergenic
1060046100 9:120342337-120342359 AATTTAGAAGACATGGGGCTGGG + Intergenic
1061564605 9:131429834-131429856 AATTAACAGCAGGTGGGGGTTGG + Intronic
1061612302 9:131755232-131755254 AATTCACAAGAGAGTGGGCTGGG + Intergenic
1186362102 X:8852940-8852962 AATGAGCAACAGATGGGGCAAGG - Intergenic
1187933704 X:24315935-24315957 AATTAAGAATGAATGGGGCTGGG - Intergenic
1188598924 X:31936868-31936890 AATTCAGAAGAGATGGTGCTGGG - Intronic
1188794753 X:34448863-34448885 AATTAAAAACAGATGAGATTTGG - Intergenic
1188888610 X:35582069-35582091 AAATTACACAAGATGGGGCTTGG + Intergenic
1188888721 X:35583054-35583076 AAATTACACAAGATGGGGCTTGG + Intergenic
1189113458 X:38318933-38318955 AATGAAGGACAGTTGGGGCTTGG - Exonic
1191607366 X:63077503-63077525 AATTAACTACAGATGATGCCAGG + Intergenic
1193159249 X:78209432-78209454 AAGAAACAACAGATGCTGCTAGG + Intergenic
1194957988 X:100203414-100203436 ATGTAAGAACAGATGGGGCGCGG + Intergenic
1194985143 X:100482077-100482099 AAATTACAATAGCTGGGGCTAGG - Intergenic
1198676747 X:139139221-139139243 AATTAATAACAGGTCGGGCATGG - Intronic
1199659402 X:150033113-150033135 AATTAAGAACAGCTAGGGGTAGG + Intergenic
1200045615 X:153399641-153399663 AATTAAGATGAGAGGGGGCTAGG - Intergenic
1200254967 X:154575819-154575841 AGTTAACATCAGATGTGGGTGGG - Intergenic
1200262802 X:154628589-154628611 AGTTAACATCAGATGTGGGTGGG + Intergenic