ID: 982727239

View in Genome Browser
Species Human (GRCh38)
Location 4:158918714-158918736
Sequence TACTGGCCACATCAACTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982727239 Original CRISPR TACTGGCCACATCAACTGTG GGG Intronic
901651476 1:10745638-10745660 GACTGGCGACATCATTTGTGGGG - Intronic
904103978 1:28061154-28061176 TACTGGCAACATACAATGTGTGG + Intronic
905317492 1:37092735-37092757 TCCTGGCTACATGAACTCTGGGG + Intergenic
905597595 1:39221576-39221598 TTCTAGCCACAGCAACTGGGAGG - Intronic
912575419 1:110666657-110666679 GACTGGCCACAAGAAATGTGAGG + Intergenic
914340736 1:146757853-146757875 GAGTGGCAACATCAGCTGTGTGG + Intergenic
914932867 1:151950169-151950191 CACTGCCCACATCCAGTGTGCGG + Intergenic
916931483 1:169582283-169582305 TACTGGCTACATAATATGTGGGG - Intronic
921788602 1:219263308-219263330 GACTGGCCTCACCAGCTGTGTGG - Intergenic
921807119 1:219467951-219467973 TACTGAATACATCAAATGTGTGG + Intergenic
922475838 1:225906485-225906507 GGCTGGCCACATCAACTTTCAGG + Intronic
923305125 1:232681641-232681663 TACTGGCCACATATACACTGAGG - Intergenic
1067733135 10:48828237-48828259 AACTGGCTACATCATATGTGAGG + Intronic
1070005413 10:72419724-72419746 TACTGGCCTCATGAATTGAGAGG - Intronic
1070006561 10:72429916-72429938 TTCTCTCCACATTAACTGTGTGG - Intronic
1071198545 10:83190711-83190733 TACCAGTCCCATCAACTGTGAGG - Intergenic
1073568050 10:104552508-104552530 TAGTGGCAACATTAATTGTGTGG + Intergenic
1073741610 10:106414367-106414389 GACTGGCCTCACCAACTGCGTGG + Intergenic
1086375116 11:86192303-86192325 TACTGGCTACATAATTTGTGAGG + Intergenic
1087168078 11:95024126-95024148 TGATGGGCAAATCAACTGTGGGG - Intergenic
1088697150 11:112377805-112377827 TACGGGCCTGAGCAACTGTGCGG - Intergenic
1091062299 11:132474859-132474881 TACCTGGCACCTCAACTGTGTGG + Intronic
1097689577 12:62721950-62721972 CACTGGCTACATCATTTGTGGGG + Intronic
1097907167 12:64932093-64932115 GATTGGCCTCACCAACTGTGTGG - Intergenic
1099855711 12:88163498-88163520 TTCTGGCCTCTTGAACTGTGAGG - Intronic
1105830040 13:24156262-24156284 TGTTGTCCACAGCAACTGTGAGG + Intronic
1109311936 13:60705328-60705350 TGTGGGCCACATCAACTTTGGGG - Intergenic
1109539260 13:63751002-63751024 TCCTGTCTAAATCAACTGTGTGG + Intergenic
1109544584 13:63828832-63828854 TCCTGTCTAAATCAACTGTGTGG - Intergenic
1109597105 13:64570568-64570590 GACTGGCCTCACCAACTGTGTGG - Intergenic
1109835931 13:67857746-67857768 GACCGGCCACACCAACTGTGAGG + Intergenic
1130817948 15:87460266-87460288 TTCTGGCCACAAGAACTGTGAGG + Intergenic
1132071189 15:98777701-98777723 TGCTCTCCCCATCAACTGTGAGG - Intronic
1132223682 15:100124384-100124406 TACTTTCCTCATCAACAGTGAGG - Intronic
1132225704 15:100139663-100139685 TAATGACCACATCACCTCTGTGG + Intronic
1133754938 16:8755372-8755394 AAGTGGCCACATCACCTCTGTGG - Intronic
1138510003 16:57503240-57503262 GACTGGCCACATCATTTTTGGGG + Intergenic
1139993547 16:70959553-70959575 GAGTGGCAACATCAGCTGTGTGG - Intronic
1142312832 16:89323796-89323818 TCAGGGCCACACCAACTGTGGGG + Intronic
1149445854 17:56712771-56712793 TTCTGGCCTCCTGAACTGTGAGG + Intergenic
1151487697 17:74411757-74411779 TACTGGCCACAGCTAGAGTGAGG + Intergenic
1151756370 17:76077410-76077432 TTCAGGCCACATCAACCGTCAGG - Exonic
1153117639 18:1678908-1678930 TACTGGCAACAGGAACTGTGCGG - Intergenic
1153994020 18:10423999-10424021 CACTGGTCACATCACCTGTGAGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1162151125 19:8646416-8646438 TTCTGGCCACGCCAGCTGTGTGG - Intergenic
1163133933 19:15295469-15295491 TTCTGGCCACAGCAACAGTTGGG - Intronic
926824305 2:16887341-16887363 TACTGGCCTCATAGACTGTTTGG + Intergenic
927175216 2:20401121-20401143 TACTCACAACATCAAATGTGTGG - Intergenic
928214531 2:29350348-29350370 CACTGGCCACAACAAATGTCTGG - Intronic
932758261 2:74423509-74423531 CAGTGGCCACTTCATCTGTGTGG + Exonic
933901780 2:86855374-86855396 TACTGGACACAACAACTTTTGGG + Intronic
934994636 2:98946060-98946082 TTCTGGCCTCTACAACTGTGAGG + Intergenic
935778767 2:106493889-106493911 TACTGGACACAACAACTTTTGGG - Intergenic
935842784 2:107131482-107131504 TGCTGGTGACATCATCTGTGGGG - Intergenic
944962748 2:204894071-204894093 TAATTGCCATTTCAACTGTGTGG + Intronic
945377496 2:209096633-209096655 TCCTGTCCATATCAATTGTGAGG - Intergenic
946721160 2:222609841-222609863 TACTGGTCACATAAAATGTGTGG + Intronic
1168749482 20:272338-272360 TACTGTCCAAGTCAACTGTATGG + Intronic
1172525598 20:35599272-35599294 TACTGGCTCCACCAAATGTGCGG + Intergenic
1174567252 20:51474139-51474161 TCCTGGCAGCATCGACTGTGCGG - Exonic
1179632779 21:42688926-42688948 CACTGGCCACGTCCACTGGGGGG - Intronic
1180136893 21:45867793-45867815 CACTGGCCACCTCCAGTGTGGGG - Intronic
1181044781 22:20209387-20209409 CACTGGCCTCATGGACTGTGGGG + Intergenic
1184339439 22:43878126-43878148 TACTGGTCATATCACCTCTGGGG + Intergenic
949733070 3:7136648-7136670 CTCTGGCCACACCAACTTTGTGG + Intronic
950425210 3:12921359-12921381 TCCTGGCCCCATCACCAGTGTGG + Intronic
955530342 3:59866262-59866284 TACTGGCCACTTCCTCTGCGTGG - Intronic
960577922 3:119245544-119245566 GACTGGCCTCACCAACTCTGTGG + Intergenic
961590728 3:127978774-127978796 TACTGGCCACGTCACCTTGGAGG + Intronic
961870065 3:129981006-129981028 TACTGGCCAGAACCACTCTGTGG + Intergenic
963008411 3:140748062-140748084 TGCTGGCATCATCCACTGTGTGG + Intergenic
963171104 3:142252083-142252105 GACTGGCCTCAACAACTGCGTGG + Intergenic
966206364 3:177410636-177410658 TACTGGGCAAAACAACAGTGTGG + Intergenic
967372321 3:188760660-188760682 TACTGGGCACTTCAAATGTAGGG - Intronic
967834404 3:193948755-193948777 TGCTTGGCACATAAACTGTGAGG - Intergenic
970343080 4:15127243-15127265 TTCTGGCCTCCTGAACTGTGAGG + Intergenic
975945036 4:79695898-79695920 GACTGGCCTCACCAACTGTGTGG - Intergenic
977079167 4:92501262-92501284 TGCTGGCCAGAGCATCTGTGAGG + Intronic
980165016 4:129215308-129215330 CACTAGCCAGATCAACAGTGAGG - Intergenic
982727239 4:158918714-158918736 TACTGGCCACATCAACTGTGGGG + Intronic
985334860 4:188881378-188881400 CACTGGCCAATTCCACTGTGAGG - Intergenic
986486639 5:8244666-8244688 TCCTGGCTGCCTCAACTGTGTGG - Intergenic
987288157 5:16480600-16480622 TACTGACCACATCAAGTATTAGG - Intronic
988482926 5:31644649-31644671 TGCTGGCCCCATCAAGAGTGTGG - Intronic
989818548 5:45765738-45765760 GACTGGCCTCACCGACTGTGTGG - Intergenic
994109076 5:95980476-95980498 CACTGGCTACATCACTTGTGAGG + Intergenic
994605838 5:101965069-101965091 CACTGGACACATCTACTGTTTGG - Intergenic
995749501 5:115439197-115439219 TACTGTCCCCAGCAACTGAGAGG - Intergenic
995810219 5:116098347-116098369 TCCTACCCACATAAACTGTGGGG + Intronic
996233211 5:121092061-121092083 AACTGGCCACCTCAGCAGTGAGG + Intergenic
997887196 5:137640576-137640598 TACTTGTCACCACAACTGTGAGG + Intronic
1004350419 6:14885890-14885912 TAGTGGCCAGACCAACAGTGTGG + Intergenic
1005632886 6:27725176-27725198 TAATTGCCACATCAACTGAATGG - Intergenic
1008895148 6:56544450-56544472 TACTACCCACCTCAAATGTGAGG - Intronic
1010879382 6:81149655-81149677 GACTGGCCTCGCCAACTGTGTGG + Intergenic
1010941851 6:81928676-81928698 TACTGGGAATATGAACTGTGTGG - Intergenic
1019787804 7:2989613-2989635 TATTGGCCACATAAAATGGGTGG - Intronic
1019813274 7:3180909-3180931 AAATCGCCACATCAAATGTGGGG - Intergenic
1020612313 7:10414612-10414634 TACTGGCCATATCAATGTTGTGG - Intergenic
1023115517 7:36858188-36858210 AACTGGCCTCATCAACTATTTGG - Intronic
1026362678 7:69617199-69617221 TCCTGGCCAGGGCAACTGTGTGG + Intronic
1027907286 7:84201330-84201352 TAATGGCAAAATCAACTGTTTGG + Intronic
1033591527 7:142812692-142812714 TATTGGCCAGATCAGCTCTGAGG - Intergenic
1037866753 8:22450247-22450269 CACTTTCCACATCAACTGTCTGG - Intronic
1038273755 8:26100552-26100574 TGCTGGCCTCACCAAATGTGCGG - Intergenic
1041541327 8:58988417-58988439 TATTTGCCACATCAACTATCTGG + Intronic
1043502507 8:80872347-80872369 TTCTGCCCACATCTACTCTGGGG + Intronic
1044657184 8:94561021-94561043 GACTGGCCCCGTCAACTGCGTGG - Intergenic
1045254531 8:100508583-100508605 TATTGTCCCCATGAACTGTGGGG - Intergenic
1045662229 8:104449859-104449881 TTCTGGCCTCCACAACTGTGAGG + Intronic
1047591968 8:126336320-126336342 TACCGGCCTCACCAACTGTGTGG + Intergenic
1050307164 9:4316503-4316525 TCCTGGCCAGATTCACTGTGTGG + Intronic
1055380307 9:75699328-75699350 GACAGGGCACATCAACTCTGAGG + Intergenic
1056177448 9:84049219-84049241 TTCTGGCCACCAGAACTGTGAGG + Intergenic
1056312832 9:85358636-85358658 AACTGGCCTCATCAACTGCATGG - Intergenic
1058880281 9:109279614-109279636 TACTGGCCACCTCAAGGGTGAGG + Intronic
1060315906 9:122510269-122510291 TACTCGCCACATTAACTTTTGGG + Intergenic
1188614992 X:32146959-32146981 TACTGGCTACATCAGTTCTGTGG + Intronic
1189301716 X:39957094-39957116 TACTGGGCACATCAGCTGTCAGG + Intergenic
1196977946 X:121180520-121180542 GACTGGCCTCACCAACTGTGTGG - Intergenic
1198417636 X:136436418-136436440 TACTGGCCACATCCAAAGGGTGG + Intergenic
1199593192 X:149486923-149486945 ACCTGGCTCCATCAACTGTGAGG + Exonic
1199715606 X:150505558-150505580 TACGGGCCACAGTAACTCTGGGG - Intronic