ID: 982731455

View in Genome Browser
Species Human (GRCh38)
Location 4:158959517-158959539
Sequence GGTATAGTATAGCCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982731455 Original CRISPR GGTATAGTATAGCCACCTCA GGG Intronic
900040691 1:461232-461254 GTTATAGTATGACCACATCAAGG + Intergenic
900062121 1:696203-696225 GTTATAGTATGACCACATCAAGG + Intergenic
900810928 1:4800845-4800867 GGCATAGTGTGGCCACCTCTGGG - Intergenic
905837749 1:41142877-41142899 GGTATGCTACAGCCACCTCTTGG - Exonic
906074603 1:43042778-43042800 GGGAGAGTGTAGCCACCTGAGGG - Intergenic
907667593 1:56447037-56447059 GGTACAGTGTACCCAGCTCAGGG - Intergenic
922981811 1:229833395-229833417 GGTATAGTATTACCACCAAATGG + Intergenic
1072230377 10:93409371-93409393 GGTTTAGTCTAGCCAGCTGATGG - Intronic
1076966964 11:97455-97477 GTTATAGTATGACCACATCAAGG + Intergenic
1092872678 12:12820109-12820131 GGTAGTGCATAGCTACCTCATGG + Intronic
1094609101 12:31976122-31976144 TGTATAGTATTACCACCTTATGG + Intronic
1105825150 13:24115796-24115818 GGAATAGAAGAGCCACTTCATGG + Intronic
1107504724 13:41022194-41022216 GGTATAGTATATCCATATAATGG + Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1122401241 14:101468821-101468843 GGTAGAGTCTAGCCGCCTGAGGG + Intergenic
1127170267 15:56293564-56293586 GGTGTAGTTTGGCCACCACATGG + Intronic
1132441211 15:101866382-101866404 GTTATAGTATGACCACATCAAGG - Intergenic
1132796576 16:1726768-1726790 GGCAGAGTATAGCCACCACCTGG - Intronic
1135393350 16:22112298-22112320 AGTATATAATAGCCACCTCATGG + Intronic
1151229594 17:72674404-72674426 GCTATAGTGTAGCCACACCATGG - Intronic
1160532862 18:79575793-79575815 GGTACAGTGCGGCCACCTCAGGG + Intergenic
1160643767 19:167078-167100 GTTATAGTATGACCACATCAAGG + Intergenic
1165641642 19:37393925-37393947 AGTGAAGTATCGCCACCTCATGG - Intergenic
928262348 2:29779193-29779215 GGCCTAGTAAAACCACCTCAAGG - Intronic
930713544 2:54571918-54571940 GTTTTAGTTTAGCCACATCATGG - Intronic
934490991 2:94762004-94762026 GGTTTGGTAAAACCACCTCAGGG + Intergenic
938329892 2:130442021-130442043 GGTTTGGTAAAACCACCTCAAGG + Intergenic
938360053 2:130679482-130679504 GGTTTGGTAAAACCACCTCAAGG - Intergenic
938436460 2:131286203-131286225 GGTTTGGTAAAACCACCTCAAGG - Intronic
940341962 2:152590925-152590947 GGGATAGTCTAGCCACGTGAGGG - Intronic
942368497 2:175256160-175256182 TGTATGGTATAGCCTCATCATGG + Intergenic
947134254 2:226961249-226961271 GGTATATTATACCCTCCTCGTGG + Intronic
1169094979 20:2889584-2889606 GGTATGGTATATCAAACTCATGG - Intronic
1169540457 20:6593958-6593980 GGGATAGAGTAGCCTCCTCAAGG + Intergenic
1171880732 20:30616114-30616136 GATTTAGTAAAACCACCTCAGGG + Intergenic
1172740775 20:37165016-37165038 GGTATTGTATATCCACATGATGG - Intronic
1176841985 21:13849389-13849411 GGTATGGTAAAACCACCCCAGGG + Intergenic
1180911656 22:19455119-19455141 GTGAGAGTCTAGCCACCTCAGGG - Intronic
1183318257 22:37148697-37148719 GGCATACTAGAGCCTCCTCATGG - Intronic
949606911 3:5663109-5663131 GCTATAGAATACCCACCTAATGG - Intergenic
954982132 3:54755739-54755761 GGAAAAGTATAGCTAACTCAAGG - Intronic
957222745 3:77405138-77405160 TGTATAGTATTGCTAGCTCAGGG + Intronic
961205309 3:125076730-125076752 GGTAATGTGTAGCCACCACATGG + Intergenic
962279254 3:134037854-134037876 AGTATAGTATATACAGCTCATGG + Intronic
965249059 3:166318503-166318525 CGTATAGACTTGCCACCTCATGG - Intergenic
968349962 3:198045945-198045967 GGTTTGGTAAAACCACCTCAGGG + Intergenic
978228154 4:106363964-106363986 GATATAATATAGTCACCTCAAGG - Intergenic
982731455 4:158959517-158959539 GGTATAGTATAGCCACCTCAGGG + Intronic
984226057 4:177036172-177036194 TGTCTTGTATGGCCACCTCAGGG - Intergenic
995620399 5:114020020-114020042 GGTATGGTATAATCTCCTCATGG + Intergenic
1002733155 5:181357703-181357725 GTTATAGTATGACCACATCAAGG - Intergenic
1002751384 6:116405-116427 GTTATAGTATGACCACATCAAGG + Intergenic
1008969312 6:57348111-57348133 GGTATAATATTGCCATCTCTAGG + Intronic
1009158286 6:60249936-60249958 GGTATAATATTGCCATCTCTAGG + Intergenic
1012254048 6:97012242-97012264 AGGATAGTATTGCCACCTCAAGG - Intronic
1015360576 6:132334626-132334648 GTTTTAGGATAGCCACTTCAGGG - Intronic
1018199783 6:161384073-161384095 GGTATAGTTAATCCACATCAGGG - Intronic
1020351857 7:7228576-7228598 GGGATAAAATAGCCATCTCATGG - Intronic
1020714636 7:11656086-11656108 GGAATATTATAGCCTCCTGAGGG - Intronic
1027383637 7:77638318-77638340 CATATAGTATAGCTACCTTAAGG + Intronic
1035510362 8:176587-176609 GTTATAGTATGACCACATCAAGG + Intergenic
1038862140 8:31399337-31399359 GGTATAGAAGAGTGACCTCATGG + Intergenic
1040105311 8:43538203-43538225 GGTTTAGTAAAACCACCTCAGGG - Intergenic
1040998407 8:53424997-53425019 GGTAGTTTATAGCTACCTCAGGG + Intergenic
1048169342 8:132090611-132090633 GATATAGTAAGACCACCTCATGG - Intronic
1053666997 9:40323685-40323707 GGTTTGGTAAAACCACCTCAGGG - Intronic
1053916588 9:42948794-42948816 GGTTTGGTAAAACCACCTCAGGG - Intergenic
1054378146 9:64463713-64463735 GGTTTGGTAAAACCACCTCAGGG - Intergenic
1054517613 9:66052598-66052620 GGTTTGGTAAAACCACCTCAGGG + Intergenic
1055845472 9:80557383-80557405 GGTATAGTAAAGCTTGCTCAAGG + Intergenic
1057675098 9:97131698-97131720 GGTTTTGTAAAACCACCTCAGGG + Intergenic
1059663694 9:116425925-116425947 GGTGTGGTATAGCATCCTCAAGG - Exonic
1062757560 9:138310025-138310047 GTTATAGTATGACCACATCAAGG - Intergenic
1186204939 X:7191380-7191402 ACTAGAGTAGAGCCACCTCAAGG - Intergenic
1197297744 X:124739684-124739706 GCTATAATATTGCCAACTCAGGG - Intronic
1197301196 X:124783003-124783025 GTTATGGTTTAGCCACCTGAAGG + Intronic
1198444210 X:136694983-136695005 GGTATGGTATTGCCACCTAAAGG + Intronic