ID: 982731570

View in Genome Browser
Species Human (GRCh38)
Location 4:158961273-158961295
Sequence CATTCTGAACTGAAGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982731570_982731574 21 Left 982731570 4:158961273-158961295 CCCTGAAGCTTCAGTTCAGAATG 0: 1
1: 1
2: 0
3: 13
4: 205
Right 982731574 4:158961317-158961339 AGAGTTCTTTGTGCTTGAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982731570 Original CRISPR CATTCTGAACTGAAGCTTCA GGG (reversed) Intronic
903511296 1:23877032-23877054 CATTGTGAACTCAAATTTCACGG - Intronic
904420859 1:30390320-30390342 ACTCCTGAGCTGAAGCTTCAAGG + Intergenic
905454173 1:38076181-38076203 CAGGCTGAAGAGAAGCTTCAGGG - Intergenic
907332859 1:53682597-53682619 CTGTCTGAACTGATTCTTCAGGG + Intronic
908193931 1:61730093-61730115 CATGCTCAACTGAAGGTTTAAGG - Intergenic
908720995 1:67125713-67125735 AATTCTGAACTGAAAATTTAAGG + Intronic
912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG + Intronic
912678910 1:111715537-111715559 TTTTCTGAACTGCAGCTGCATGG + Exonic
913009006 1:114664400-114664422 CATTCTGATCTTAAACTTCTGGG - Intronic
916279503 1:163033509-163033531 CATTCTGAATTGAGTCTTAAGGG - Intergenic
921435735 1:215118817-215118839 AATTCTGAACTGCAGGTACAAGG - Intronic
923859620 1:237880284-237880306 TATTCTGAAAAGAAGTTTCATGG + Intronic
1063169481 10:3494785-3494807 CTTTAGGAACTGAAGCTTGAGGG + Intergenic
1064852668 10:19726968-19726990 AACTCTGAACTGAAGCTCCATGG - Intronic
1066616436 10:37299829-37299851 CAGTGTGACCTGAAGATTCATGG - Intronic
1067242828 10:44510610-44510632 CACTCTGCACTGAAGCTGCCTGG + Intergenic
1067480732 10:46595799-46595821 CATTCTGAACACAGGCTGCAGGG + Intergenic
1067614007 10:47746002-47746024 CATTCTGAACACAGGCTGCAGGG - Intergenic
1071522077 10:86337615-86337637 CATTCAGAACTGTAACTTCCAGG - Intronic
1071629416 10:87205977-87205999 CATTCTGAACACAGGCTGCAGGG - Intergenic
1071921291 10:90353940-90353962 CATTCTGGAAGGAAGCTTCTTGG - Intergenic
1073188451 10:101632097-101632119 CCTTCTGATCTGGAGCTTCTTGG - Intronic
1075622421 10:123937645-123937667 CATTGTGAATTTGAGCTTCAAGG - Intronic
1076256339 10:129028296-129028318 CATTCTGAACAGGAGCATCTAGG - Intergenic
1079123881 11:17705042-17705064 CATTCTGAACTGAATCTTCAAGG + Intergenic
1079225510 11:18601241-18601263 CATTCTCCACTGAGACTTCAGGG - Intergenic
1081778102 11:45690870-45690892 CATTCTTAGCAGAAGCATCAAGG + Intergenic
1086192220 11:84093215-84093237 CATTCTCATCTCAAGGTTCAGGG + Intronic
1088291944 11:108248526-108248548 CTTTCTGAAATGAAGATACAGGG - Intronic
1089528946 11:119114130-119114152 CATCCTGCACTGAGGCTTCCAGG - Exonic
1093718091 12:22406772-22406794 CATTCTTAACTGGAGCCTCATGG - Intronic
1096447711 12:51709074-51709096 ATTTCTGAACTGAAGCTTAAAGG + Intronic
1097969896 12:65622212-65622234 TGTTCTGAACAGAGGCTTCATGG - Intergenic
1098981875 12:76965020-76965042 CTTTAAAAACTGAAGCTTCAAGG - Intergenic
1099952046 12:89314588-89314610 CATTCTGAACCTAAGCAACAGGG - Intergenic
1102920079 12:116785171-116785193 ACTTCTGAACTGACGCCTCAAGG - Intronic
1104327359 12:127812129-127812151 CATCCTGAAGTGAAGCAGCAGGG + Intergenic
1104561390 12:129848322-129848344 CATCCTGAAATGAAGCATGAAGG + Intronic
1105073976 12:133259296-133259318 CATTATGAACCCAAGGTTCAAGG - Intergenic
1105073987 12:133259367-133259389 CATTATGAACCCAAGGTTCAAGG - Intergenic
1107735828 13:43397647-43397669 CATTCAGAAGTAAAGCCTCAAGG + Intronic
1110365166 13:74674716-74674738 CCCTCTGAATAGAAGCTTCATGG - Intergenic
1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG + Intergenic
1113090522 13:106613237-106613259 CATTCTCAACAGAAAGTTCAGGG + Intergenic
1115452779 14:33567183-33567205 CAGTGGGGACTGAAGCTTCAGGG - Intronic
1119169144 14:72519674-72519696 CATTCTGCTTTGAAGCTGCAAGG - Intronic
1119754712 14:77107710-77107732 AAATCTGTACTGAAGCTACATGG - Intronic
1121593809 14:95142888-95142910 CATTCAGATCTGAAGCCTAAAGG + Intronic
1122777363 14:104126773-104126795 CATACTCAGCTGAAGATTCAAGG + Intergenic
1124382054 15:29175532-29175554 CAGTCTGAACTGATTCTCCAGGG + Intronic
1126925095 15:53576351-53576373 CATTCTGAAATTAAGTTTTAAGG + Intronic
1128902569 15:71437966-71437988 GCTTCAGAACTGAACCTTCAGGG + Intronic
1129035566 15:72646610-72646632 CAGACTGAGCTGCAGCTTCAGGG + Intergenic
1129214318 15:74090606-74090628 CAGACTGAGCTGCAGCTTCAGGG - Intergenic
1129399689 15:75274763-75274785 CAGACTGAGCTGCAGCTTCAGGG + Intronic
1129473217 15:75766548-75766570 CAGACTGAGCTGCAGCTTCAGGG - Intergenic
1129731462 15:77934954-77934976 CAGACTGAGCTGCAGCTTCAGGG - Intergenic
1138862004 16:60769951-60769973 AATAATTAACTGAAGCTTCAGGG - Intergenic
1139782498 16:69363619-69363641 CATTCTCACCCCAAGCTTCATGG - Intronic
1140536106 16:75711526-75711548 CACACTGATCTGAAGCTTGATGG - Intronic
1140688807 16:77461086-77461108 TGATCTGAATTGAAGCTTCATGG - Intergenic
1142782036 17:2188777-2188799 CAGTCTGAGCTGGAGCTGCATGG + Intronic
1144647641 17:16986570-16986592 CATTCTGCCCTCAAGCTCCAAGG - Intergenic
1146585445 17:34078026-34078048 CATTCTGGACAGAAGCTGTAGGG - Intronic
1148582918 17:48755799-48755821 CCTTATGACCTGAAGCTTCTTGG - Intergenic
1149036761 17:52142904-52142926 CATTCTCAACTCAAGCTATATGG + Intronic
1149248916 17:54745315-54745337 AGTTCTCAGCTGAAGCTTCAAGG - Intergenic
1150776850 17:68087940-68087962 CATTCTTCACTAAAGCTGCAAGG - Intergenic
1150980594 17:70137423-70137445 CATTCAGAACAGAAGAATCAAGG - Intergenic
1154384692 18:13882339-13882361 CAATCAGAACAGAAGCTTCAGGG - Exonic
1156006683 18:32450823-32450845 ACTTCTGAACAGAAGCTTTAAGG + Intronic
1156426677 18:37020838-37020860 CATTCAAAACTAAAGCTTCAGGG + Intronic
1156549896 18:38004454-38004476 CCTTTTGGACAGAAGCTTCAGGG + Intergenic
1156600279 18:38597627-38597649 TATTCTGAATAGAAGGTTCAGGG + Intergenic
1157177713 18:45466507-45466529 CATTTTGAACTCATGCCTCAAGG - Intronic
1159484989 18:69043946-69043968 CATTCTGAACTAAAATTTCAGGG - Intronic
1161108177 19:2454933-2454955 CAGTCTGCACTGAAGCCTCGGGG + Intronic
1161688419 19:5715957-5715979 CATTCTCAACGGCAGGTTCAGGG + Intronic
1163090990 19:15020481-15020503 CACTCTGAACTTCTGCTTCAAGG + Exonic
1166911739 19:46163913-46163935 CATCCTGGGATGAAGCTTCAGGG - Intergenic
926380971 2:12288873-12288895 CTTTCTGAACTGAAGATTTCTGG - Intergenic
927117985 2:19923997-19924019 CAGCCTGAATGGAAGCTTCATGG - Intronic
928207568 2:29297117-29297139 AATTCTCCACTGAAGTTTCAAGG + Intronic
928623647 2:33117306-33117328 CAGCCTGAACTGAAGCCTGAAGG - Intronic
932094411 2:68834849-68834871 TAATCTGAACAGAAACTTCAGGG + Intergenic
932605991 2:73166079-73166101 CATCCTGTACAGAAGCATCAGGG + Intergenic
932880714 2:75499432-75499454 CATTCTGGACTGACCCTTTATGG - Intronic
932965552 2:76470895-76470917 CATTCTTTACTGAAATTTCAAGG - Intergenic
933124854 2:78592550-78592572 CATTCAGAACTGCAGCTCTAAGG - Intergenic
933926434 2:87094371-87094393 CATCCTGTACAGAAGCATCAGGG - Intergenic
937497243 2:122433792-122433814 CATTCTGAATTCATTCTTCATGG + Intergenic
938649584 2:133368648-133368670 CATTTTGAAATGAAGCATGAAGG + Intronic
939011965 2:136856863-136856885 AATACTAAACTGAAGATTCAAGG - Intronic
939694301 2:145305111-145305133 AATTATGAACTCAAACTTCATGG + Intergenic
941266605 2:163370687-163370709 CATTCTTAACGGAAGATACAGGG + Intergenic
941509406 2:166387131-166387153 CATTCTGATCTCTAGCATCAAGG + Intergenic
942572215 2:177326096-177326118 CTTTCTGAGATGAAGCTACATGG + Intronic
946567576 2:220983993-220984015 CATTCTTAGCTGTAGCTTCTAGG - Intergenic
948644688 2:239397165-239397187 CAAGCTGAACTTCAGCTTCAAGG + Intronic
948948145 2:241232043-241232065 CAATCTGGACAGAAGCTTCTTGG - Intronic
1169524856 20:6413282-6413304 CATCCTCAGCTGAAGCTTCCTGG - Intergenic
1169551405 20:6705289-6705311 CATTCCAAACTGAGTCTTCAAGG + Intergenic
1170163697 20:13341980-13342002 AGTTCTGAACTTAGGCTTCAAGG - Intergenic
1171796025 20:29567432-29567454 GATTCCGAACTGGAGCGTCAGGG + Intergenic
1171852205 20:30316716-30316738 GATTCCGAACTGGAGCGTCAGGG - Intergenic
1172039546 20:32034460-32034482 CATTCCGACCTGAGGCTACAGGG + Intergenic
1172083919 20:32363709-32363731 CTTTCTGAGCTGAATCTTGAAGG + Intronic
1173500825 20:43551818-43551840 CAATGTGAACTGAACCCTCAGGG + Intronic
1174790251 20:53471572-53471594 CCATCTGAACTGAGACTTCAAGG + Intronic
1175228150 20:57457085-57457107 CTTTCAGAACTGAGGCTTCCTGG + Intergenic
1177326902 21:19602326-19602348 GATTATGAACTCAAGGTTCAAGG + Intergenic
1178876970 21:36421103-36421125 CACTCAGAACTGAAACTTGAGGG - Intergenic
1182187777 22:28425305-28425327 CATGCAGAACTGAAGATTCTTGG - Intronic
1184255689 22:43285588-43285610 CATTCTGAGCTGAGCCCTCAGGG - Intronic
1184558762 22:45248828-45248850 TCTTCTGAACTGGAGCCTCAGGG - Intergenic
1184791194 22:46701195-46701217 CATCCTGGACTGAAGCCTCGAGG + Intronic
949299540 3:2567798-2567820 CATTTTGAACTGATTCTTAAAGG - Intronic
949391252 3:3564970-3564992 CTTTCTAGACTGAAGATTCATGG - Intergenic
950885978 3:16363094-16363116 CATTCTGAACTTCAGCCTCATGG - Intronic
951440632 3:22719159-22719181 CATTCTAAACTCAAACTTTAGGG + Intergenic
954618722 3:51983817-51983839 CATTCTGAGCACAAACTTCATGG + Intronic
955835881 3:63054610-63054632 CATTCTGAACACAGGCTTTAGGG - Intergenic
956961228 3:74403480-74403502 GCTTCTGAACTGAAGTTTCTGGG - Intronic
959373197 3:105555314-105555336 AATTCTCATCTGAAGCATCAAGG + Intronic
961744676 3:129056865-129056887 CTTCCTGATCTGAAGCTTCGTGG - Intergenic
963033934 3:141008516-141008538 GATTCTGAACTGAATCTTTTTGG - Intergenic
963750772 3:149177319-149177341 CATTTTTAACTGAATTTTCATGG - Intronic
963975223 3:151472903-151472925 CACACTGCAGTGAAGCTTCAGGG + Intergenic
963988633 3:151627497-151627519 CATTCTGACCTCAAGCTTGTGGG - Intergenic
964793935 3:160477829-160477851 CAGACTGAAATGAAGCTTCGAGG - Intronic
965193937 3:165569773-165569795 CTTTCTGAACTGAAAATTAAAGG + Intergenic
965971250 3:174558981-174559003 CATTCTGAACTGAATGTCCCAGG - Intronic
967154016 3:186676260-186676282 TATTCTTAACTGAGGCTTGATGG - Intronic
972138836 4:35929656-35929678 CATTTTTAACTGCATCTTCAGGG - Intergenic
972206311 4:36777374-36777396 CTTCCTGGACTGAAGCTTCCTGG - Intergenic
975161273 4:71127275-71127297 GGTCCTGAACTTAAGCTTCATGG + Intergenic
975455270 4:74583021-74583043 ATTTCTGAACTGAAGCTCAAGGG + Intergenic
975736893 4:77389680-77389702 CATCCTGACCTGATGCTACAGGG - Intronic
977441775 4:97076797-97076819 CATTCTGAACTGCAGCTACCAGG + Intergenic
977599106 4:98916701-98916723 GATTCTGAAGTCAAGTTTCATGG - Intronic
978234355 4:106440150-106440172 CATTCTTAACTGTAGCTATATGG + Intergenic
980220554 4:129908338-129908360 TATTCTGAAGAGAAGTTTCAGGG - Intergenic
980543972 4:134233248-134233270 AATTCTGAATTGAAACTTCCTGG - Intergenic
981512689 4:145574724-145574746 CAATCTGAGATGGAGCTTCAAGG + Intergenic
982638772 4:157930058-157930080 CTTTATTATCTGAAGCTTCAGGG - Intergenic
982731570 4:158961273-158961295 CATTCTGAACTGAAGCTTCAGGG - Intronic
985510987 5:313829-313851 CATGCTGGCCTGAATCTTCAGGG + Intronic
986276684 5:6281371-6281393 AATTCTGAACTGTAGCTCCATGG - Intergenic
986418171 5:7549369-7549391 CCTTCTGAGCAGAAGCTTTAGGG - Intronic
986425299 5:7625332-7625354 CAGAATGAACTGAAGCTTCTTGG + Intronic
990795033 5:59530127-59530149 CATTCTGCAATGGTGCTTCATGG - Intronic
993187524 5:84638063-84638085 AATACTTTACTGAAGCTTCAGGG - Intergenic
995528706 5:113071982-113072004 GATTCAGAACTGTAGATTCAGGG + Intronic
996134482 5:119822712-119822734 CTTTCTGAACTCAATCTTCCTGG - Intergenic
996812453 5:127532525-127532547 CATTTTGAGCTGAAGCTTAATGG + Intronic
997651810 5:135527481-135527503 CATTTGGAACTGAAGCTGAAGGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000179734 5:158796620-158796642 CATTAGGACCTGAAACTTCAGGG + Intronic
1000340022 5:160269732-160269754 CGTTCTGACCTGAATCTTCCTGG + Intronic
1000638881 5:163677364-163677386 AATTCTGAACTTAAGCAGCAAGG - Intergenic
1000931618 5:167258845-167258867 CATTGTGAACTGTAGCATTATGG - Intergenic
1007734568 6:43972512-43972534 CATGCAGACCTGAAGCTCCAGGG - Intergenic
1007763447 6:44147602-44147624 CAGTGGGAACTGAGGCTTCAAGG - Intronic
1010093018 6:72006736-72006758 CAGTCTGAAATCAAGCTGCAAGG + Intronic
1010442863 6:75918586-75918608 CATTCTGTACATAAGCCTCATGG + Intronic
1010987161 6:82438064-82438086 CATTCTGAACTTGATCTGCATGG - Intergenic
1011098507 6:83694632-83694654 GATTCTGAACTAAAGCTCCCAGG - Intronic
1011943611 6:92873139-92873161 CATTCTGAAGTTTAGCTGCAAGG - Intergenic
1012980066 6:105819909-105819931 CATTCTGAGCTTCAGCTCCACGG - Intergenic
1014896592 6:126908113-126908135 CATACTGAACTAAACCTTCGGGG - Intergenic
1016381235 6:143483456-143483478 CATTCTGGGCAGAAGCTACAGGG + Intronic
1016719710 6:147281779-147281801 CCTTCTGAACAGATTCTTCAAGG - Intronic
1017299686 6:152842240-152842262 ATTTCTGAACTGAAGAATCAAGG - Intergenic
1018225356 6:161622787-161622809 CCTTCTGAAATGAATTTTCAAGG + Intronic
1018684566 6:166293932-166293954 GATTCAGAACTGATGCTTCTTGG - Intergenic
1020484014 7:8698217-8698239 AATACTCAACTGAAGATTCATGG + Intronic
1021324813 7:19253763-19253785 TCTTCTCACCTGAAGCTTCAGGG - Intergenic
1023343891 7:39251703-39251725 CAGTCTGAACTGTAGCATCCTGG + Intronic
1024003543 7:45208492-45208514 CATTTTTAACTGAAGACTCAAGG + Intergenic
1025109213 7:56198925-56198947 CATTGTAAACTGAAGCCTCTAGG + Intergenic
1025586472 7:62795451-62795473 CATTCTGAAATATAACTTCACGG - Intergenic
1026278081 7:68897758-68897780 CATTATTAAATGAAGCATCAAGG + Intergenic
1027629721 7:80587793-80587815 CATTCAGAACTGAAGTTGTAAGG + Intronic
1028291142 7:89066307-89066329 CATTGTGCCCTGAAGCTACAGGG + Intronic
1028291143 7:89066314-89066336 CATTGTGCCCTGTAGCTTCAGGG - Intronic
1029166800 7:98597391-98597413 ATTTCTGAAATGCAGCTTCAAGG - Intergenic
1030127022 7:106163437-106163459 CATTCAGAACTGTAGCTGCAAGG + Intergenic
1030763089 7:113375390-113375412 CACTCTGAACTGATGCATTATGG + Intergenic
1031439949 7:121781870-121781892 GCTTATGAATTGAAGCTTCAAGG - Intergenic
1032933839 7:136705973-136705995 TCTTCTGAACTGAATTTTCATGG - Intergenic
1033849919 7:145482515-145482537 CATACTCATCTGAAGCTTGATGG + Intergenic
1034542210 7:151765503-151765525 CTTTCTGCCCTGCAGCTTCAGGG + Intronic
1034621472 7:152460599-152460621 TTTTCTGAACTGTATCTTCAGGG - Intergenic
1034692875 7:153028077-153028099 GATTCTGAACTCCAGCTTCACGG + Intergenic
1035494741 7:159314512-159314534 CATTATGAACCCAAGGTTCAAGG - Intergenic
1036461241 8:8954742-8954764 TACTGTGAACTGAAGCTTCCTGG + Intergenic
1041412070 8:57567603-57567625 CTTTCTTAACTGTACCTTCAAGG + Intergenic
1041595646 8:59647799-59647821 CATTCTGTATTGTAGCTTGAGGG + Intergenic
1046497431 8:115033653-115033675 CATTCTGAAGAGACGCTTCTAGG + Intergenic
1048725033 8:137373811-137373833 CATTCTGAATTTATGCTGCAGGG + Intergenic
1048955985 8:139536368-139536390 CAATATAAACTAAAGCTTCATGG - Intergenic
1049677993 8:143901731-143901753 GATTCTCAACTGAAGGTTCTTGG + Intergenic
1050412100 9:5377006-5377028 CATTCTGAAATGAAGGCTTAAGG - Intronic
1051334879 9:16057238-16057260 CTTTGGGAACTGAACCTTCATGG - Intronic
1052068448 9:24052078-24052100 GATTCTGAAGTCAAGCTTCCAGG + Intergenic
1052458491 9:28732037-28732059 CATCCTCAACTGAACCTTCCGGG + Intergenic
1053789992 9:41679993-41680015 GATTCCGAACTGGAGCGTCAGGG - Intergenic
1054155146 9:61634764-61634786 GATTCCGAACTGGAGCGTCAGGG + Intergenic
1054178331 9:61891682-61891704 GATTCCGAACTGGAGCGTCAGGG - Intergenic
1054474939 9:65565872-65565894 GATTCCGAACTGGAGCGTCAGGG + Intergenic
1054659198 9:67689142-67689164 GATTCCGAACTGGAGCGTCAGGG + Intergenic
1055197440 9:73613336-73613358 CATACTGAACTGAAGTTAAATGG - Intergenic
1057477940 9:95420271-95420293 CATTTTGAACACAAGCTCCAGGG - Intergenic
1058743605 9:107968214-107968236 CACTCTGAACTCATTCTTCAGGG + Intergenic
1060147764 9:121267467-121267489 CATCCTGAATTGCCGCTTCATGG - Intronic
1060442493 9:123654926-123654948 GCTTCTGAACTGAGGCTTGATGG - Intronic
1189870446 X:45376867-45376889 CATTTTGAACTGTAGATTAATGG - Intergenic
1193393486 X:80956964-80956986 CACACTGCAGTGAAGCTTCAGGG - Intergenic
1193690296 X:84633855-84633877 CATTGTGAACTTTTGCTTCAAGG + Intergenic
1200834374 Y:7718409-7718431 CATTCTGAACTTCAGCCTCATGG - Intergenic