ID: 982737630

View in Genome Browser
Species Human (GRCh38)
Location 4:159022712-159022734
Sequence CCCCTTCAGGAAGACTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982737624_982737630 17 Left 982737624 4:159022672-159022694 CCTGCAATGCCCTAGATACGGAT 0: 1
1: 0
2: 0
3: 2
4: 30
Right 982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG 0: 1
1: 0
2: 2
3: 15
4: 191
982737626_982737630 8 Left 982737626 4:159022681-159022703 CCCTAGATACGGATTGTGGTTAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG 0: 1
1: 0
2: 2
3: 15
4: 191
982737627_982737630 7 Left 982737627 4:159022682-159022704 CCTAGATACGGATTGTGGTTAGC 0: 1
1: 0
2: 0
3: 4
4: 25
Right 982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG 0: 1
1: 0
2: 2
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982737630 Original CRISPR CCCCTTCAGGAAGACTGTGA TGG Intronic
900211977 1:1460652-1460674 CCCCCTCAGGAAGACTTTCTGGG - Intronic
900644337 1:3702267-3702289 CCCCTCCAGGAGGGCTGTGGAGG - Intronic
900662396 1:3791341-3791363 CCTCTGTAGGAAGACTGGGAGGG - Intronic
900986400 1:6075392-6075414 CTCCATCAGGAACACAGTGATGG + Intronic
903216887 1:21848281-21848303 CCCCTCCAGAAAGCCTGTTAAGG + Intronic
903351454 1:22719210-22719232 CCCTTTCAGGATGGCTGTGAAGG - Intronic
903930982 1:26862418-26862440 CATCTTCAGGTAGACTGAGAAGG + Intergenic
906438142 1:45814891-45814913 CCCCTTCAGGGAAACTTTTATGG + Intronic
907786324 1:57616685-57616707 CCCCTTTAGGCAATCTGTGATGG + Intronic
908695880 1:66841271-66841293 CCCCTGAAGTAAGACAGTGAAGG + Intronic
909467685 1:75991646-75991668 CCTGTTCAGGAAAACTGTGAGGG - Intergenic
910291886 1:85607404-85607426 CCCCACCAGGAAGAACGTGAGGG - Intergenic
910662367 1:89687593-89687615 GCCCTTGAAGAAGACTGAGAAGG + Intronic
915015362 1:152728041-152728063 TGCCTTCAGGAAGTCTGTCATGG - Intergenic
915781996 1:158562686-158562708 GGCCTTCAGGAAGACAGTGATGG - Exonic
918194439 1:182208228-182208250 CCCCTTCATTAAGGCTCTGAGGG + Intergenic
920323620 1:205143968-205143990 GCGCTTCAGGAGGACTGTGCTGG - Exonic
920759885 1:208773024-208773046 CCACTTGAGGAACAGTGTGATGG - Intergenic
920822941 1:209398360-209398382 CCTCTGCTGGAACACTGTGAGGG - Intergenic
922498427 1:226078988-226079010 TCACTTAGGGAAGACTGTGAGGG + Intergenic
922852274 1:228743200-228743222 CCCTTTCATGAAAAATGTGAAGG + Intronic
922961355 1:229648587-229648609 CCCCTATAGCAAGCCTGTGAAGG + Intronic
923915065 1:238492498-238492520 CGCCTGCTGGAAGACAGTGAGGG + Intergenic
1069637449 10:69934380-69934402 TCCCTCCAAGGAGACTGTGATGG + Intronic
1070583968 10:77747192-77747214 CTCCTCCAGGAAGCCTCTGAAGG - Intergenic
1071754427 10:88520835-88520857 AATCTTCAGGAAGACTGTTAAGG - Intronic
1078498052 11:11841035-11841057 CTCCTTCATGAAGACTTTTATGG - Intergenic
1080868848 11:36218764-36218786 ACCATTCAGGCAGACAGTGAGGG - Intronic
1081664085 11:44906370-44906392 CCCCATCGGGAAGACTGAGGTGG + Intronic
1082224244 11:49683609-49683631 CCCCATTAGGAAGAGTGTGATGG - Intergenic
1082988362 11:59186640-59186662 CCCCATCTGTAAAACTGTGAGGG - Intronic
1084505459 11:69564081-69564103 CCCTTTCCGGAAGTCTGTGGTGG + Intergenic
1085108106 11:73863219-73863241 CTCCTTCAGGAAGACTGCTTTGG - Exonic
1086449893 11:86905667-86905689 CACCTTCTGGAAAAGTGTGAAGG - Intronic
1086624802 11:88935585-88935607 CCCCATTAGGAAGAGTGTGATGG + Intronic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1087146953 11:94822028-94822050 TACCTTCAGTAAGAGTGTGAAGG + Intronic
1087617980 11:100510355-100510377 TCCATTCAGGACAACTGTGAGGG - Intergenic
1088754557 11:112875091-112875113 CCCCTTCAGGATGTCATTGAGGG + Intergenic
1088894806 11:114069832-114069854 CCACTCAAGGAAGGCTGTGAGGG - Intronic
1089868562 11:121652602-121652624 GCCCTTCTGGAGGACTGTGAGGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092677439 12:10936876-10936898 CTGCTTCAGAAAGACTGTTATGG - Intronic
1093370251 12:18356290-18356312 CCCCTTCATGAATCCTGTGAAGG - Intronic
1093653633 12:21672217-21672239 TCCCTTCAGGAAGAAAGTCAAGG + Intronic
1094509212 12:31086005-31086027 GCCCTGCAGACAGACTGTGAAGG - Intronic
1096238478 12:49945713-49945735 CCCCTGCTGGAGCACTGTGATGG - Intergenic
1103435531 12:120922516-120922538 CACCTTCAGTGACACTGTGAGGG + Intergenic
1105439174 13:20401688-20401710 CAGCTTCAGGAAGACAGTTATGG - Intergenic
1107079928 13:36364061-36364083 AGCAATCAGGAAGACTGTGATGG - Intronic
1111128154 13:83939124-83939146 CCCCTTCAAAAACACTGTCAGGG + Intergenic
1112004360 13:95241577-95241599 CACCTCCATGGAGACTGTGATGG - Intronic
1114142766 14:19934221-19934243 CCACTTCAGGAAGGGTGTGTAGG + Intergenic
1114683325 14:24505646-24505668 CCCCTACAGGGAGACTCTGGGGG - Exonic
1117641717 14:57807275-57807297 CCCCTCCAGGAGGAGGGTGAAGG - Intronic
1118439816 14:65802097-65802119 CCCAGTCAGAAAGACAGTGAGGG - Intergenic
1120038760 14:79728531-79728553 CCGCAGCAGGAAGACTTTGAAGG + Intronic
1122989183 14:105228866-105228888 TGACTTCAGGAGGACTGTGAAGG - Exonic
1123976390 15:25558332-25558354 CCCCTTCAGGAGGCCCCTGATGG + Intergenic
1126915339 15:53460121-53460143 CCCCTTGGGGAACACTGTCAAGG + Intergenic
1127566495 15:60194257-60194279 CCTCTTCAGGTAGCCTGTGGTGG - Intergenic
1127692636 15:61412926-61412948 CCCCTACAGGAAGACTGGGCAGG - Intergenic
1129362203 15:75030894-75030916 CCAAATCAGGGAGACTGTGAGGG + Intronic
1129590864 15:76913816-76913838 GCCCTGAAGTAAGACTGTGAAGG - Intergenic
1132994061 16:2813911-2813933 CCCCTCCAGGGAGACGGTGCAGG - Intergenic
1137804157 16:51287748-51287770 ACTCATCAGGAAGACTCTGATGG - Intergenic
1138952606 16:61931649-61931671 GCCCCTCAGAAAGATTGTGAGGG + Intronic
1140162439 16:72512061-72512083 ACCCTCTAGGAAGACTTTGACGG - Intergenic
1141592699 16:85079026-85079048 CCCCGTCAGTAAGAGGGTGACGG - Intronic
1141649194 16:85384198-85384220 CCCCATCAGGAAGCCTGGGCTGG - Intergenic
1141748537 16:85942652-85942674 CTGCTTCAGGTAGACTCTGAAGG - Intergenic
1143523873 17:7461717-7461739 TCCCTGGAGGAAGACTGAGAGGG + Exonic
1144105272 17:11978627-11978649 CCCCTCAAGGAAGCCTGAGAAGG + Exonic
1145867215 17:28248974-28248996 CCTATTCAGGATGACTGAGAAGG - Intergenic
1145883624 17:28368616-28368638 CCCAGTCAGGAGGAGTGTGAAGG - Exonic
1146655286 17:34631351-34631373 CCACTGCTGGAAGACTGGGATGG + Intronic
1146916816 17:36683115-36683137 CGCCATCAGGAAAACTGTGTTGG + Intergenic
1147677362 17:42217370-42217392 CCACTTCAGGAATATGGTGAGGG - Exonic
1148208185 17:45792610-45792632 CCAGTTCAGGAAGACTTTGGTGG - Intronic
1148460494 17:47836741-47836763 CTCCTTGAGGAAGCCTGGGAGGG - Exonic
1148514370 17:48202319-48202341 CCCCATCAGGAAGAACTTGATGG + Intronic
1149304453 17:55334776-55334798 CCCTTTCAGCAACCCTGTGAGGG + Intergenic
1150807334 17:68329607-68329629 CCCCTGCTGGGAGGCTGTGATGG + Intronic
1150846435 17:68663432-68663454 TCCCATCTGGAACACTGTGATGG + Intergenic
1151214853 17:72570550-72570572 CCCCTTCAGGCTGCCTCTGATGG - Intergenic
1151284078 17:73097151-73097173 CTCCTCCTGGAAGACTGTGGTGG + Intergenic
1153002191 18:465753-465775 CTCCTTTAGAAAGACTGGGAAGG - Intronic
1154341810 18:13509362-13509384 CCCCTCCTGGATGACTCTGAGGG + Intronic
1160324992 18:77937839-77937861 CTCCTTCAGGACAACTTTGAGGG - Intergenic
1160840901 19:1146700-1146722 CCCCTTGGGGAAGGCTGTGAGGG + Intronic
1161497162 19:4592964-4592986 CCCCTACAGGAAGGCAGTGGAGG - Intergenic
1161887152 19:7005756-7005778 CCCCTTCAAGAAGAATTCGAGGG + Intergenic
1162332338 19:10037999-10038021 CCCCATGAGGAAGACAGTGTTGG + Intergenic
1165073302 19:33267874-33267896 CTCCTTCAGGAAGACTCTGGGGG - Intergenic
1165565828 19:36726827-36726849 TGGTTTCAGGAAGACTGTGAAGG - Intronic
1167373233 19:49097177-49097199 CCTTTTCAGGAAGACAGTGTGGG - Intronic
1168260027 19:55188110-55188132 CCACGTCAGGAAGAATGAGAGGG - Exonic
925163169 2:1701070-1701092 CACTTTCAGCAAGACTGGGACGG - Intronic
926057659 2:9784540-9784562 CCCCTTGTGGATGACTTTGAGGG + Intergenic
927406739 2:22779181-22779203 CCATTTAAGGAAGACTGTGGTGG - Intergenic
928312635 2:30223278-30223300 TCCCTCCAGAAGGACTGTGATGG + Intergenic
928913237 2:36444068-36444090 CCTTTTCAGGAAGACCCTGAAGG - Intronic
931248388 2:60509792-60509814 CCTGTTCAGGAAGATCGTGAGGG - Intronic
932480460 2:72036100-72036122 CCCCTGCAGGAAGCTTCTGAGGG - Intergenic
933229480 2:79789765-79789787 GCCCCTCATCAAGACTGTGATGG + Intronic
933331052 2:80893662-80893684 CCCCTTCAGGACCAATGTCAAGG - Intergenic
936091724 2:109505888-109505910 CCTCTCCAGACAGACTGTGATGG - Intergenic
938337689 2:130513740-130513762 GCCTTTCAGGAAGACTGGGTGGG - Intergenic
938352150 2:130606995-130607017 GCCTTTCAGGAAGACTGGGTGGG + Intergenic
938803842 2:134787959-134787981 TCCCTCCAGGTAGACAGTGAAGG - Intergenic
939548420 2:143582629-143582651 CTCCTTCAGAAAGTCTGTGTGGG + Intronic
940797319 2:158094172-158094194 TACCTTCAGGAAGAAAGTGAAGG + Intronic
942002455 2:171662355-171662377 CCTCTTCAGGAATTCTGTGGGGG + Intergenic
943809178 2:192162640-192162662 CCACTTCATGAATACAGTGAAGG + Intronic
944365482 2:198913943-198913965 CACTTTCAGGAAGTCTGTAAGGG + Intergenic
946048394 2:216840351-216840373 TTCCTTCGGGAAGACTCTGAGGG + Intergenic
946967103 2:225047774-225047796 CCCCATCAGAAAGTCGGTGACGG - Intergenic
1169282578 20:4280086-4280108 CCCCTGGAGGAAGCCTGTGCAGG - Intergenic
1169859469 20:10136120-10136142 CCTCTTTGGGAAGACTGGGAAGG - Intergenic
1170574807 20:17654183-17654205 CTCCTACAGGGAGACTGTGAAGG - Intronic
1175778413 20:61667206-61667228 CACCCTCAGGAAGGCTGAGAGGG + Intronic
1178570808 21:33735334-33735356 CCCCTGCAGGAAGATAGTGCTGG + Intronic
1180099574 21:45578269-45578291 GCCCTTCAGGGAGCCTGGGAGGG + Intergenic
1181406569 22:22689171-22689193 CCATTTGAGAAAGACTGTGAAGG - Intergenic
1181636994 22:24179040-24179062 CCCCATTAGGGCGACTGTGATGG - Intergenic
1181791749 22:25272965-25272987 CCCATTCAGAAAGACATTGATGG + Intergenic
1181827385 22:25528769-25528791 CCCATTCAGAAAGACATTGATGG + Intergenic
1182514111 22:30843180-30843202 ACCCTCCAGGATGACTTTGAGGG - Intronic
1182782614 22:32880326-32880348 CCTCTTCAGGAAAACTGTGAGGG + Intronic
1183371653 22:37435909-37435931 TGCCTTGAGGAAGACTGGGAAGG + Intergenic
951848148 3:27106615-27106637 ACCTTTAAGGCAGACTGTGAAGG - Intergenic
952847895 3:37703835-37703857 CCTCATCAGGAAAACTGAGATGG - Intronic
953697414 3:45170878-45170900 CCCCTGCTGGGAGACCGTGAGGG - Intergenic
955341804 3:58130745-58130767 CCCCTTCAGGGTTCCTGTGAAGG + Exonic
956008053 3:64801574-64801596 ACCCTGCAGGAAGAATGGGATGG + Intergenic
956686693 3:71835652-71835674 CATCTTCAGGAAGACTGTCTAGG - Intergenic
957114382 3:76005565-76005587 ACCTTTTAGGAAGTCTGTGATGG + Intronic
959455907 3:106561599-106561621 CAACTTCAGGAAGACTGTGTTGG + Intergenic
959964255 3:112335699-112335721 ATCCATCAGGAATACTGTGATGG + Intronic
962994820 3:140615557-140615579 CCTCCTCAGGAAGACTGAAATGG + Intergenic
966869200 3:184278936-184278958 TCTCTTCAGGAAGACTTTGCTGG - Intronic
968829416 4:2924984-2925006 CTCCTTCAGCAGGGCTGTGATGG + Intronic
969375701 4:6761933-6761955 CAGCTGCAGGAAGCCTGTGAAGG - Intergenic
972002652 4:34058418-34058440 CCCCATTAGGAACACTGTGTGGG + Intergenic
978327590 4:107576666-107576688 CCCATTCTGGGAGACTCTGATGG + Intergenic
979836942 4:125382095-125382117 ACCCTTAAGGATGACTTTGAAGG - Intronic
981011983 4:139934548-139934570 CCCCCTCAGAAAGAGGGTGAGGG + Intronic
982073267 4:151714328-151714350 CCCCTTTAGGACCACTGTGTTGG - Intronic
982306420 4:153936227-153936249 CTCCCTCAGGAAAAGTGTGATGG + Intergenic
982737630 4:159022712-159022734 CCCCTTCAGGAAGACTGTGATGG + Intronic
984246008 4:177275799-177275821 CCCCTTCATGAGTCCTGTGAAGG + Intergenic
985564761 5:609899-609921 CCCCTCCTGCAAGACTGTGAAGG - Intergenic
988563113 5:32298555-32298577 GCCCTCCAGGTAGACTGTAAAGG + Intronic
992842114 5:80705686-80705708 CTCCTTCTTGAGGACTGTGAAGG + Intronic
992949464 5:81843671-81843693 CACCTTGAGGAAAAGTGTGAGGG + Intergenic
994242871 5:97444783-97444805 CCCAGTGAGGAAGACTGGGATGG + Intergenic
995256618 5:110053886-110053908 CCCCCTCAGGAAGCCTCTGAGGG + Intergenic
999091062 5:148936169-148936191 CCCCTCCAGGAAGACGTTGGTGG + Intronic
999130815 5:149281946-149281968 CCACAGCAGGAAGAGTGTGAAGG - Intronic
1000242887 5:159424998-159425020 CCCCTACAGCAAGGCTGTTAAGG - Intergenic
1000463719 5:161550058-161550080 CCTCTTCTGGAAAACTGAGAAGG + Intronic
1001935426 5:175700182-175700204 ACCCTTGAGGGAGACAGTGAGGG - Intergenic
1002334435 5:178468266-178468288 CCCCTGCAGGAAGATCGGGAAGG + Intronic
1002334845 5:178470521-178470543 CCCCTGCAGGAAGACTGGGAAGG + Intronic
1003878559 6:10460001-10460023 CTCCTTCAGGAAGACTGCTTTGG + Intergenic
1004441689 6:15661240-15661262 CCACTTCAGGAAGCCTAGGAGGG + Intronic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1007573592 6:42910691-42910713 CCCCTTCAGGAATGCTGACAGGG - Intergenic
1009770419 6:68137519-68137541 CCCCTGAGGGAGGACTGTGAAGG + Intergenic
1012319899 6:97830123-97830145 CACCTTCAGGCAAAGTGTGATGG - Intergenic
1013732059 6:113179938-113179960 CCCCTTTAGAAGGAATGTGAAGG - Intergenic
1014699914 6:124672246-124672268 CCCCTTGATGATGACAGTGAAGG - Intronic
1016647799 6:146429972-146429994 CCCCTTCAGGCAGTTTGTGCAGG + Intronic
1018235350 6:161718300-161718322 CAACTGCAGGAAGACTGAGATGG + Intronic
1018385641 6:163300480-163300502 TCCCTGCAGGAAGAGAGTGAGGG - Intronic
1018694633 6:166382392-166382414 CCCCTTCAGGGAGTGGGTGACGG - Intronic
1018847567 6:167566210-167566232 CCCACTCAGGAGGACTGGGAAGG - Intergenic
1018955236 6:168405256-168405278 CCCCTTCAGTGGGACAGTGAAGG + Intergenic
1020039056 7:4987473-4987495 GCCTTTCAGGAAGACTGGGTGGG - Intronic
1020156237 7:5726993-5727015 GCCTTTCAGGAAGACTGGGTGGG + Intronic
1031450006 7:121904296-121904318 CCCCAGAAGGAAGACAGTGAAGG + Intronic
1037503335 8:19506088-19506110 GCACATCAGGAAGGCTGTGATGG - Exonic
1037703823 8:21298287-21298309 CACCTTCAGGAAGCAAGTGATGG + Intergenic
1037810309 8:22082724-22082746 CTCCTTCAGGGACTCTGTGATGG + Intergenic
1039781842 8:40793826-40793848 CTTCTTCAGGAAAAGTGTGACGG + Intronic
1041362733 8:57069914-57069936 ATCCTTCAGGAAAAATGTGAGGG - Intergenic
1045289578 8:100821067-100821089 CCCCCTCAGCAAGGCTGTGATGG + Intergenic
1046609687 8:116409943-116409965 CCCCTTCAGGCAGACTTAAAAGG + Intergenic
1047674536 8:127185758-127185780 CCCCTTCTAGCTGACTGTGATGG - Intergenic
1048410893 8:134171418-134171440 CTGCTTCAGGAAGTCTGGGATGG - Intergenic
1049103203 8:140594147-140594169 CCCATTCAGGGAGATGGTGATGG - Intronic
1049734896 8:144199659-144199681 CCCCTCCAGGATGGCTATGAGGG - Intronic
1050706711 9:8408109-8408131 CCTCTTAAGGAAGAGTGAGATGG + Intronic
1051175693 9:14357343-14357365 TCCCTGAAGGAACACTGTGATGG + Intronic
1052243955 9:26310866-26310888 CCCTTTCACTAAGACTATGAGGG - Intergenic
1052273743 9:26655287-26655309 GCCCTTCAGGAGAACTGTGTAGG + Intergenic
1052588985 9:30466361-30466383 CTCCTTCAGGAGTCCTGTGAAGG + Intergenic
1055016583 9:71625072-71625094 CCCCTTTAGAAAGAAGGTGAAGG + Intergenic
1056433324 9:86550266-86550288 CAGTTTCAGGAAAACTGTGATGG + Intergenic
1056977049 9:91267556-91267578 CCACTTGCGGAAGACTCTGAGGG - Intronic
1058982053 9:110179169-110179191 CCCCTTAAGAAATACTGTGCTGG + Intergenic
1186245743 X:7614927-7614949 CCTCCTCAGAAAGACTGAGATGG + Intergenic
1186666805 X:11725177-11725199 TTCCTTCAGGAATATTGTGAAGG + Intergenic
1187897283 X:23994167-23994189 CCACATCTGGAAGACAGTGAAGG + Intronic
1189371972 X:40435876-40435898 CTCCTTCAGGAAGATTGGGCTGG - Intergenic
1190415181 X:50173927-50173949 CCCCTTCAGGAAAACACAGAAGG - Intergenic
1195647490 X:107249351-107249373 CGCCTTCAGGAGTCCTGTGAAGG - Intergenic
1197170278 X:123426266-123426288 AGCCTTCAGCAACACTGTGAAGG + Intronic
1201464250 Y:14262767-14262789 CCTCCTCAGAAAGACTCTGACGG + Intergenic