ID: 982740254

View in Genome Browser
Species Human (GRCh38)
Location 4:159050454-159050476
Sequence TCTTAAGGCTCTCTGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982740254_982740258 28 Left 982740254 4:159050454-159050476 CCCAGACTCAGAGAGCCTTAAGA No data
Right 982740258 4:159050505-159050527 TTTAAAATGTTAAGATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982740254 Original CRISPR TCTTAAGGCTCTCTGAGTCT GGG (reversed) Intergenic
No off target data available for this crispr