ID: 982742612

View in Genome Browser
Species Human (GRCh38)
Location 4:159073625-159073647
Sequence CTGGATTAGGAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982742612_982742619 5 Left 982742612 4:159073625-159073647 CCATCCTCCCTCTCCTAATCCAG No data
Right 982742619 4:159073653-159073675 TTTCCCTTCAGGAAATAATCTGG No data
982742612_982742617 -6 Left 982742612 4:159073625-159073647 CCATCCTCCCTCTCCTAATCCAG No data
Right 982742617 4:159073642-159073664 ATCCAGTCATTTTTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982742612 Original CRISPR CTGGATTAGGAGAGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr