ID: 982743079

View in Genome Browser
Species Human (GRCh38)
Location 4:159078375-159078397
Sequence CTTTTCGAAATTCAGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982743079_982743085 25 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743085 4:159078423-159078445 ATGGAAATGGCTCTGTCCTAAGG No data
982743079_982743086 26 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743086 4:159078424-159078446 TGGAAATGGCTCTGTCCTAAGGG No data
982743079_982743082 6 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743082 4:159078404-159078426 GTGCGGAGTTCCTACTGGCATGG No data
982743079_982743083 12 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743083 4:159078410-159078432 AGTTCCTACTGGCATGGAAATGG No data
982743079_982743081 1 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743081 4:159078399-159078421 TGAGAGTGCGGAGTTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982743079 Original CRISPR CTTTTCGAAATTCAGAAACT TGG (reversed) Intergenic