ID: 982743082

View in Genome Browser
Species Human (GRCh38)
Location 4:159078404-159078426
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982743079_982743082 6 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743082 4:159078404-159078426 GTGCGGAGTTCCTACTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type