ID: 982743083 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:159078410-159078432 |
| Sequence | AGTTCCTACTGGCATGGAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982743079_982743083 | 12 | Left | 982743079 | 4:159078375-159078397 | CCAAGTTTCTGAATTTCGAAAAG | No data | ||
| Right | 982743083 | 4:159078410-159078432 | AGTTCCTACTGGCATGGAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982743083 | Original CRISPR | AGTTCCTACTGGCATGGAAA TGG | Intergenic | ||