ID: 982743083

View in Genome Browser
Species Human (GRCh38)
Location 4:159078410-159078432
Sequence AGTTCCTACTGGCATGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982743079_982743083 12 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743083 4:159078410-159078432 AGTTCCTACTGGCATGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982743083 Original CRISPR AGTTCCTACTGGCATGGAAA TGG Intergenic