ID: 982743086

View in Genome Browser
Species Human (GRCh38)
Location 4:159078424-159078446
Sequence TGGAAATGGCTCTGTCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982743079_982743086 26 Left 982743079 4:159078375-159078397 CCAAGTTTCTGAATTTCGAAAAG No data
Right 982743086 4:159078424-159078446 TGGAAATGGCTCTGTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982743086 Original CRISPR TGGAAATGGCTCTGTCCTAA GGG Intergenic
No off target data available for this crispr