ID: 982745793

View in Genome Browser
Species Human (GRCh38)
Location 4:159103340-159103362
Sequence CCGCGGCGGCGCCGGCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745788_982745793 -10 Left 982745788 4:159103327-159103349 CCGGGTGCTCTGGCCGCGGCGGC No data
Right 982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG No data
982745780_982745793 10 Left 982745780 4:159103307-159103329 CCGGAGGGCTGCAGCCCGGGCCG No data
Right 982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG No data
982745784_982745793 -4 Left 982745784 4:159103321-159103343 CCCGGGCCGGGTGCTCTGGCCGC No data
Right 982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG No data
982745785_982745793 -5 Left 982745785 4:159103322-159103344 CCGGGCCGGGTGCTCTGGCCGCG No data
Right 982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG No data
982745776_982745793 25 Left 982745776 4:159103292-159103314 CCGAGAGCGACTGGGCCGGAGGG 0: 1
1: 0
2: 2
3: 6
4: 108
Right 982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745793 Original CRISPR CCGCGGCGGCGCCGGCGCCG GGG Intergenic
No off target data available for this crispr