ID: 982745972

View in Genome Browser
Species Human (GRCh38)
Location 4:159103967-159103989
Sequence GGCGGCCGAGAGCGCGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745972_982745981 5 Left 982745972 4:159103967-159103989 CCTGTACCGCGCTCTCGGCCGCC No data
Right 982745981 4:159103995-159104017 CAGCCGAGCCGCCCCCCCGCGGG No data
982745972_982745990 27 Left 982745972 4:159103967-159103989 CCTGTACCGCGCTCTCGGCCGCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745972_982745980 4 Left 982745972 4:159103967-159103989 CCTGTACCGCGCTCTCGGCCGCC No data
Right 982745980 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745972 Original CRISPR GGCGGCCGAGAGCGCGGTAC AGG (reversed) Intergenic