ID: 982745975

View in Genome Browser
Species Human (GRCh38)
Location 4:159103973-159103995
Sequence GGGCCCGGCGGCCGAGAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745975_982745981 -1 Left 982745975 4:159103973-159103995 CCGCGCTCTCGGCCGCCGGGCCC No data
Right 982745981 4:159103995-159104017 CAGCCGAGCCGCCCCCCCGCGGG No data
982745975_982745994 26 Left 982745975 4:159103973-159103995 CCGCGCTCTCGGCCGCCGGGCCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745975_982745980 -2 Left 982745975 4:159103973-159103995 CCGCGCTCTCGGCCGCCGGGCCC No data
Right 982745980 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
982745975_982745990 21 Left 982745975 4:159103973-159103995 CCGCGCTCTCGGCCGCCGGGCCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745975 Original CRISPR GGGCCCGGCGGCCGAGAGCG CGG (reversed) Intergenic