ID: 982745976

View in Genome Browser
Species Human (GRCh38)
Location 4:159103985-159104007
Sequence GGCGGCTCGGCTGGGCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745976_982745990 9 Left 982745976 4:159103985-159104007 CCGCCGGGCCCAGCCGAGCCGCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745976_982745999 28 Left 982745976 4:159103985-159104007 CCGCCGGGCCCAGCCGAGCCGCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745976_982745994 14 Left 982745976 4:159103985-159104007 CCGCCGGGCCCAGCCGAGCCGCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745976_982746000 29 Left 982745976 4:159103985-159104007 CCGCCGGGCCCAGCCGAGCCGCC No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745976 Original CRISPR GGCGGCTCGGCTGGGCCCGG CGG (reversed) Intergenic