ID: 982745977

View in Genome Browser
Species Human (GRCh38)
Location 4:159103988-159104010
Sequence GGGGGCGGCTCGGCTGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745977_982746002 30 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data
982745977_982746001 29 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745977_982745990 6 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745977_982746000 26 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data
982745977_982745999 25 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745977_982745994 11 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745977 Original CRISPR GGGGGCGGCTCGGCTGGGCC CGG (reversed) Intergenic