ID: 982745979

View in Genome Browser
Species Human (GRCh38)
Location 4:159103994-159104016
Sequence CCGCGGGGGGGCGGCTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745979_982746001 23 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745979_982745999 19 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745979_982746000 20 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data
982745979_982746004 28 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982746004 4:159104045-159104067 CTGATTAGTCGCGGGCGGGCGGG No data
982745979_982745994 5 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745979_982746003 27 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982746003 4:159104044-159104066 GCTGATTAGTCGCGGGCGGGCGG No data
982745979_982745990 0 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745979_982746002 24 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745979 Original CRISPR CCGCGGGGGGGCGGCTCGGC TGG (reversed) Intergenic