ID: 982745982

View in Genome Browser
Species Human (GRCh38)
Location 4:159103998-159104020
Sequence GGGCCCGCGGGGGGGCGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745982_982745990 -4 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745982_982746004 24 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982746004 4:159104045-159104067 CTGATTAGTCGCGGGCGGGCGGG No data
982745982_982746001 19 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745982_982746005 27 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982746005 4:159104048-159104070 ATTAGTCGCGGGCGGGCGGGCGG No data
982745982_982746006 28 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982746006 4:159104049-159104071 TTAGTCGCGGGCGGGCGGGCGGG No data
982745982_982746003 23 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982746003 4:159104044-159104066 GCTGATTAGTCGCGGGCGGGCGG No data
982745982_982745994 1 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745982_982746002 20 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data
982745982_982745999 15 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745982_982746000 16 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745982 Original CRISPR GGGCCCGCGGGGGGGCGGCT CGG (reversed) Intergenic