ID: 982745983

View in Genome Browser
Species Human (GRCh38)
Location 4:159104003-159104025
Sequence GCGCGGGGCCCGCGGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745983_982746006 23 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982746006 4:159104049-159104071 TTAGTCGCGGGCGGGCGGGCGGG No data
982745983_982746003 18 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982746003 4:159104044-159104066 GCTGATTAGTCGCGGGCGGGCGG No data
982745983_982745994 -4 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745983_982745999 10 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745983_982746001 14 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745983_982746000 11 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data
982745983_982746002 15 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data
982745983_982746004 19 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982746004 4:159104045-159104067 CTGATTAGTCGCGGGCGGGCGGG No data
982745983_982746005 22 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982746005 4:159104048-159104070 ATTAGTCGCGGGCGGGCGGGCGG No data
982745983_982745990 -9 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745983 Original CRISPR GCGCGGGGCCCGCGGGGGGG CGG (reversed) Intergenic