ID: 982745986

View in Genome Browser
Species Human (GRCh38)
Location 4:159104008-159104030
Sequence CGGCGGCGCGGGGCCCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745986_982746004 14 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982746004 4:159104045-159104067 CTGATTAGTCGCGGGCGGGCGGG No data
982745986_982746000 6 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data
982745986_982746005 17 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982746005 4:159104048-159104070 ATTAGTCGCGGGCGGGCGGGCGG No data
982745986_982746003 13 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982746003 4:159104044-159104066 GCTGATTAGTCGCGGGCGGGCGG No data
982745986_982746006 18 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982746006 4:159104049-159104071 TTAGTCGCGGGCGGGCGGGCGGG No data
982745986_982746001 9 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745986_982745994 -9 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745986_982745999 5 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745986_982746002 10 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745986 Original CRISPR CGGCGGCGCGGGGCCCGCGG GGG (reversed) Intergenic