ID: 982745987

View in Genome Browser
Species Human (GRCh38)
Location 4:159104009-159104031
Sequence GCGGCGGCGCGGGGCCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1074
Summary {0: 1, 1: 3, 2: 20, 3: 146, 4: 904}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745987_982746005 16 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746005 4:159104048-159104070 ATTAGTCGCGGGCGGGCGGGCGG No data
982745987_982746002 9 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data
982745987_982746001 8 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745987_982746003 12 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746003 4:159104044-159104066 GCTGATTAGTCGCGGGCGGGCGG No data
982745987_982746007 30 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746007 4:159104062-159104084 GGCGGGCGGGCGCAGCGCGCAGG No data
982745987_982746000 5 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data
982745987_982746006 17 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746006 4:159104049-159104071 TTAGTCGCGGGCGGGCGGGCGGG No data
982745987_982745994 -10 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745987_982746004 13 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982746004 4:159104045-159104067 CTGATTAGTCGCGGGCGGGCGGG No data
982745987_982745999 4 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC 0: 1
1: 3
2: 20
3: 146
4: 904
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745987 Original CRISPR GCGGCGGCGCGGGGCCCGCG GGG (reversed) Intergenic