ID: 982745988

View in Genome Browser
Species Human (GRCh38)
Location 4:159104010-159104032
Sequence GGCGGCGGCGCGGGGCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745988_982746002 8 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data
982745988_982746008 30 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746008 4:159104063-159104085 GCGGGCGGGCGCAGCGCGCAGGG No data
982745988_982745999 3 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745988_982746000 4 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data
982745988_982746006 16 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746006 4:159104049-159104071 TTAGTCGCGGGCGGGCGGGCGGG No data
982745988_982746001 7 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745988_982746004 12 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746004 4:159104045-159104067 CTGATTAGTCGCGGGCGGGCGGG No data
982745988_982746007 29 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746007 4:159104062-159104084 GGCGGGCGGGCGCAGCGCGCAGG No data
982745988_982746005 15 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746005 4:159104048-159104070 ATTAGTCGCGGGCGGGCGGGCGG No data
982745988_982746003 11 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982746003 4:159104044-159104066 GCTGATTAGTCGCGGGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745988 Original CRISPR GGCGGCGGCGCGGGGCCCGC GGG (reversed) Intergenic