ID: 982745990

View in Genome Browser
Species Human (GRCh38)
Location 4:159104017-159104039
Sequence GCCCCGCGCCGCCGCCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745979_982745990 0 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG 0: 1
1: 0
2: 1
3: 30
4: 322
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745977_982745990 6 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745982_982745990 -4 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745978_982745990 1 Left 982745978 4:159103993-159104015 CCCAGCCGAGCCGCCCCCCCGCG No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745983_982745990 -9 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC 0: 1
1: 1
2: 15
3: 167
4: 1253
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745976_982745990 9 Left 982745976 4:159103985-159104007 CCGCCGGGCCCAGCCGAGCCGCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745972_982745990 27 Left 982745972 4:159103967-159103989 CCTGTACCGCGCTCTCGGCCGCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data
982745975_982745990 21 Left 982745975 4:159103973-159103995 CCGCGCTCTCGGCCGCCGGGCCC No data
Right 982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745990 Original CRISPR GCCCCGCGCCGCCGCCGCCG CGG Intergenic
No off target data available for this crispr