ID: 982745992

View in Genome Browser
Species Human (GRCh38)
Location 4:159104019-159104041
Sequence AACCGCGGCGGCGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745992_982746003 2 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746003 4:159104044-159104066 GCTGATTAGTCGCGGGCGGGCGG No data
982745992_982746002 -1 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746002 4:159104041-159104063 TTGGCTGATTAGTCGCGGGCGGG No data
982745992_982746008 21 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746008 4:159104063-159104085 GCGGGCGGGCGCAGCGCGCAGGG No data
982745992_982746009 24 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746009 4:159104066-159104088 GGCGGGCGCAGCGCGCAGGGCGG No data
982745992_982746001 -2 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746001 4:159104040-159104062 TTTGGCTGATTAGTCGCGGGCGG No data
982745992_982746007 20 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746007 4:159104062-159104084 GGCGGGCGGGCGCAGCGCGCAGG No data
982745992_982746006 7 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746006 4:159104049-159104071 TTAGTCGCGGGCGGGCGGGCGGG No data
982745992_982746005 6 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746005 4:159104048-159104070 ATTAGTCGCGGGCGGGCGGGCGG No data
982745992_982745999 -6 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745992_982746010 27 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746010 4:159104069-159104091 GGGCGCAGCGCGCAGGGCGGAGG No data
982745992_982746000 -5 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746000 4:159104037-159104059 CGGTTTGGCTGATTAGTCGCGGG No data
982745992_982746004 3 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982746004 4:159104045-159104067 CTGATTAGTCGCGGGCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745992 Original CRISPR AACCGCGGCGGCGGCGGCGC GGG (reversed) Intergenic