ID: 982745994

View in Genome Browser
Species Human (GRCh38)
Location 4:159104022-159104044
Sequence GCGCCGCCGCCGCCGCGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745983_982745994 -4 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745986_982745994 -9 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745984_982745994 -7 Left 982745984 4:159104006-159104028 CCCCCCCGCGGGCCCCGCGCCGC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745976_982745994 14 Left 982745976 4:159103985-159104007 CCGCCGGGCCCAGCCGAGCCGCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745982_982745994 1 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745978_982745994 6 Left 982745978 4:159103993-159104015 CCCAGCCGAGCCGCCCCCCCGCG No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745977_982745994 11 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745979_982745994 5 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745985_982745994 -8 Left 982745985 4:159104007-159104029 CCCCCCGCGGGCCCCGCGCCGCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745975_982745994 26 Left 982745975 4:159103973-159103995 CCGCGCTCTCGGCCGCCGGGCCC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data
982745987_982745994 -10 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC No data
Right 982745994 4:159104022-159104044 GCGCCGCCGCCGCCGCGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745994 Original CRISPR GCGCCGCCGCCGCCGCGGTT TGG Intergenic