ID: 982745999

View in Genome Browser
Species Human (GRCh38)
Location 4:159104036-159104058
Sequence GCGGTTTGGCTGATTAGTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982745983_982745999 10 Left 982745983 4:159104003-159104025 CCGCCCCCCCGCGGGCCCCGCGC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745984_982745999 7 Left 982745984 4:159104006-159104028 CCCCCCCGCGGGCCCCGCGCCGC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745993_982745999 -7 Left 982745993 4:159104020-159104042 CCGCGCCGCCGCCGCCGCGGTTT No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745989_982745999 2 Left 982745989 4:159104011-159104033 CCGCGGGCCCCGCGCCGCCGCCG No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745978_982745999 20 Left 982745978 4:159103993-159104015 CCCAGCCGAGCCGCCCCCCCGCG No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745987_982745999 4 Left 982745987 4:159104009-159104031 CCCCGCGGGCCCCGCGCCGCCGC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745977_982745999 25 Left 982745977 4:159103988-159104010 CCGGGCCCAGCCGAGCCGCCCCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745992_982745999 -6 Left 982745992 4:159104019-159104041 CCCGCGCCGCCGCCGCCGCGGTT No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745988_982745999 3 Left 982745988 4:159104010-159104032 CCCGCGGGCCCCGCGCCGCCGCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745976_982745999 28 Left 982745976 4:159103985-159104007 CCGCCGGGCCCAGCCGAGCCGCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745991_982745999 -5 Left 982745991 4:159104018-159104040 CCCCGCGCCGCCGCCGCCGCGGT No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745985_982745999 6 Left 982745985 4:159104007-159104029 CCCCCCGCGGGCCCCGCGCCGCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745982_982745999 15 Left 982745982 4:159103998-159104020 CCGAGCCGCCCCCCCGCGGGCCC No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745986_982745999 5 Left 982745986 4:159104008-159104030 CCCCCGCGGGCCCCGCGCCGCCG No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data
982745979_982745999 19 Left 982745979 4:159103994-159104016 CCAGCCGAGCCGCCCCCCCGCGG No data
Right 982745999 4:159104036-159104058 GCGGTTTGGCTGATTAGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982745999 Original CRISPR GCGGTTTGGCTGATTAGTCG CGG Intergenic