ID: 982751948

View in Genome Browser
Species Human (GRCh38)
Location 4:159172649-159172671
Sequence CATGCTACTTCCTCTGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982751948 Original CRISPR CATGCTACTTCCTCTGTAAG TGG Intronic
901645855 1:10716356-10716378 CATGTGACTTCCTCTGGAAATGG - Intronic
905148513 1:35907247-35907269 CATGCTATTTCTCCTATAAGAGG - Intronic
905289063 1:36909023-36909045 AATGTTACTTCCTCTCTAATGGG - Intronic
908479219 1:64520769-64520791 CATGCTACGTGCTCAGTAAATGG - Intronic
911101353 1:94098298-94098320 CATGCTTCTTCCTCTGGAAATGG - Intronic
916888600 1:169095074-169095096 CATGCTATTTCCTCTGTGTCTGG - Intergenic
922723801 1:227913207-227913229 CCTCCAACTTCCTCTCTAAGGGG + Intergenic
922966550 1:229695685-229695707 CATAATACTTTCTGTGTAAGTGG + Intergenic
923313583 1:232758400-232758422 CATGTTACTCCCTCTATAATTGG + Intergenic
1064228842 10:13511705-13511727 CATACTAAGTGCTCTGTAAGTGG - Intronic
1065757813 10:28950274-28950296 CATTCTACTTGCTTTGGAAGAGG - Intergenic
1071752989 10:88502502-88502524 CATGCTACTTCCACTCAAGGTGG - Intronic
1072438728 10:95435957-95435979 CTTGCTTCTTCCTCTGAAAATGG - Intronic
1072493988 10:95936312-95936334 AATGCTACTTCTTTTGTAAGAGG + Intronic
1074895373 10:117772967-117772989 AATCTTACTTCCTCTTTAAGTGG + Intergenic
1079660968 11:23035903-23035925 CATGCTACCCCTCCTGTAAGGGG + Intergenic
1085983213 11:81749754-81749776 CATTGTCCTTCCTCTGTATGTGG - Intergenic
1086143821 11:83528484-83528506 CATGCTTTTTCCTATGTATGTGG + Intronic
1086286451 11:85256645-85256667 CATGCTCCTCCTCCTGTAAGGGG + Intronic
1089611367 11:119671341-119671363 CAAGCTGCTCCCTTTGTAAGAGG - Intronic
1091451163 12:572641-572663 CAAGGTATGTCCTCTGTAAGTGG - Intronic
1092984351 12:13831152-13831174 CATGCTGCTTCCTCTGAAGGTGG - Intronic
1093268770 12:17031747-17031769 CAAGCTGCTTCCTCTGTCAAGGG + Intergenic
1093420954 12:18974337-18974359 CATGCTTCTTCTTCTTTAAAAGG - Intergenic
1099888053 12:88556110-88556132 CCTGCTACTTCCTCTCTCAGGGG - Intronic
1100432989 12:94547045-94547067 CTTTCTACTTCCTCTGCAGGTGG + Intergenic
1105512892 13:21065853-21065875 CCTTATACTTCCTCTGAAAGGGG + Intergenic
1107023485 13:35775671-35775693 CAGGCTACATCCTTTTTAAGGGG - Intronic
1108249615 13:48551302-48551324 CATGCTGATTCATCTGTGAGTGG - Intergenic
1110058920 13:71016025-71016047 CACCCTAATTCCTATGTAAGGGG - Intergenic
1112869259 13:103949622-103949644 GATGCTCATACCTCTGTAAGTGG - Intergenic
1113110638 13:106819629-106819651 CATGCTATTTCCTCTTTCACAGG - Intergenic
1114058046 14:18992070-18992092 CATGGTTCTTCCTCCGAAAGTGG - Intronic
1114104502 14:19409684-19409706 CATGGTTCTTCCTCCGAAAGTGG + Intronic
1119201462 14:72755905-72755927 CCTGCTCTTCCCTCTGTAAGTGG - Intronic
1119725019 14:76917019-76917041 CATGGTACTTCCTCCTTCAGAGG + Intergenic
1121159849 14:91727358-91727380 CATGGTTCTTCCTCTGTCACTGG - Intronic
1121686405 14:95838518-95838540 CCTGCTGCTGCCTCTGTTAGGGG + Intergenic
1126380346 15:48040124-48040146 CTTTCTATTCCCTCTGTAAGTGG + Intergenic
1126963640 15:54027101-54027123 CATGCTATTTCCTCTGCCTGAGG - Intronic
1131461806 15:92622822-92622844 CCTGTTCCTTCCTCTGTGAGAGG + Intronic
1132782782 16:1637322-1637344 CATTCTCCTTCCTCAGTAAGAGG - Intronic
1133078501 16:3298533-3298555 CATGTTACTTTCACAGTAAGAGG + Intronic
1133124622 16:3638179-3638201 CATGATACTTCTGCTGTAAGCGG - Intronic
1133763588 16:8819842-8819864 CACTGTGCTTCCTCTGTAAGAGG - Intronic
1134261830 16:12657107-12657129 CCTGCTAATTCCTCTCTCAGAGG - Intergenic
1136087789 16:27897914-27897936 CATTCTAGGTCCTCTGTAAACGG + Intronic
1138800690 16:60024649-60024671 CATGGTTCTTCCTCAGAAAGTGG + Intergenic
1142170346 16:88618750-88618772 AAGGCTACTTCCTCAGTCAGAGG + Intronic
1144710781 17:17400132-17400154 CATGCTACTTCGTCTTACAGTGG - Intergenic
1147000972 17:37361774-37361796 CAAGCTATTACGTCTGTAAGAGG + Intronic
1147112963 17:38277458-38277480 CATTCTCCTTCCTCTGTCACAGG + Intergenic
1148416658 17:47511767-47511789 CATTCTCCTTCCTCTGTCACAGG - Intergenic
1153817281 18:8801437-8801459 CGTGCTACTCTTTCTGTAAGAGG + Intronic
1155775774 18:29758554-29758576 GAAGATACTTCCTCTGTAGGTGG + Intergenic
1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG + Intergenic
1157382153 18:47228243-47228265 CATGCCACTTCCTTGGTCAGTGG + Intronic
1158013505 18:52756613-52756635 CATGCTTTTTCCTTTTTAAGTGG - Intronic
1159487715 18:69086386-69086408 TATGTTTCTTCTTCTGTAAGGGG + Intergenic
1159726639 18:71968204-71968226 CATGATCCTCCTTCTGTAAGGGG + Intergenic
1159885610 18:73901604-73901626 TATGCCATTTCCTCTGAAAGTGG + Intergenic
1161164346 19:2778091-2778113 CCTGTCACTCCCTCTGTAAGAGG - Intronic
1168426876 19:56246005-56246027 CATGCTCCTTCCAGTGTCAGGGG + Intronic
925629965 2:5882062-5882084 CCTGCAACTTCCTCTGCAAAAGG + Intergenic
925754779 2:7122980-7123002 CATGTTTCTTGCTCTGGAAGAGG + Intergenic
925809400 2:7684349-7684371 CTTGCTGCTGCCTCTGTAAGTGG + Intergenic
927970184 2:27300945-27300967 CATCCTCCTGCCTCTGTTAGAGG + Intronic
929010561 2:37439396-37439418 CATGTTACTACATCTGTCAGTGG - Intergenic
931076251 2:58716549-58716571 CATGCTACTTCTCCTGGAGGAGG + Intergenic
933425999 2:82112801-82112823 CATGCTCCCTCTCCTGTAAGCGG + Intergenic
936946448 2:117935331-117935353 CATGCGTCTTACTCTGTAATGGG - Intronic
938283172 2:130082156-130082178 CATGGTTCTTCCTCAGGAAGTGG + Intronic
938319205 2:130351839-130351861 CAGCATACTTCCTCTGTATGCGG - Intergenic
938432438 2:131256744-131256766 CATGGTTCTTCCTCAGGAAGTGG - Intronic
942305355 2:174601776-174601798 CCTGTTTCTTCCTCTGTAAGTGG - Intronic
944707245 2:202303016-202303038 CATGGTTCTTCCTCAGAAAGTGG - Exonic
945479045 2:210323160-210323182 CATGCTGCTTCCCCTGGAGGTGG + Intergenic
947522892 2:230862162-230862184 CATGCTACCTCCTCTTGGAGGGG - Intergenic
948118922 2:235514518-235514540 CAGGCCACTTCCTCTGTCTGGGG + Intronic
1169607625 20:7340248-7340270 CATGCTACATCCACTGTCAAGGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171515730 20:25732387-25732409 CATGCCCTTCCCTCTGTAAGTGG - Intergenic
1174346962 20:49937100-49937122 CATTCTACTTCCTGTGTAGGAGG + Intronic
1176948468 21:15013786-15013808 AATGCTCTTTCCTTTGTAAGAGG + Intronic
1177604997 21:23366944-23366966 CATGCTCCCCCTTCTGTAAGGGG - Intergenic
1177971866 21:27800058-27800080 CATGCTAATGCTTCTGGAAGTGG - Intergenic
1179944400 21:44661445-44661467 GACGCCACTTCATCTGTAAGTGG - Intronic
1180476531 22:15714686-15714708 CATGGTTCTTCCTCCGAAAGTGG - Intronic
1181626367 22:24124827-24124849 CCTGCTACTTCTGCTGCAAGGGG + Intronic
1182525081 22:30910523-30910545 CATGTTACGTTCTCTGTCAGAGG - Intergenic
1183355839 22:37358949-37358971 CCTCCTGCTTCCTATGTAAGTGG - Intergenic
1184413621 22:44339684-44339706 CATGCTACTGCCTTTTTAAAGGG + Intergenic
953921696 3:46956387-46956409 CATGCTGCCTCCTCTTCAAGAGG + Intronic
954924502 3:54220616-54220638 CCTGCTGCTTCCTCTGCATGAGG + Intronic
955628699 3:60948840-60948862 CATACTGCTTCATCTGTAAGTGG - Intronic
959155763 3:102664371-102664393 CATGCTCCCTCTTCTGCAAGGGG + Intergenic
964071961 3:152646143-152646165 CATCCTACTTGCTCTGTGAAAGG + Intergenic
965549157 3:169946691-169946713 CATACTTTTTCCTCTGCAAGGGG + Intergenic
965779898 3:172274229-172274251 TATACTACTGCTTCTGTAAGAGG - Intronic
968309474 3:197671503-197671525 TCTTCAACTTCCTCTGTAAGTGG - Intronic
970239669 4:13995336-13995358 AATGCCACATCCTCTGGAAGGGG + Intergenic
970821077 4:20214888-20214910 CATGCTAATGCCTGTGTAAAAGG - Intergenic
971697681 4:29927883-29927905 CATGTTAATTGCTCTGTAAGTGG - Intergenic
975060039 4:69985905-69985927 CATGCTTCCCCTTCTGTAAGAGG - Intergenic
975496358 4:75039843-75039865 CATGCTGATCCCTCTGTGAGAGG + Intronic
977634836 4:99285484-99285506 CATGCTCCCTCCACTGTAACAGG - Intronic
977660463 4:99579427-99579449 CTTGCTGTTTCCTCTGTGAGGGG + Intronic
978375964 4:108076066-108076088 CATGCTACTCCATCTGCATGTGG + Intronic
978710860 4:111779219-111779241 CATCCTGCTTGCTCTCTAAGAGG + Intergenic
978787169 4:112622762-112622784 CATGCTTTTTCCTCTTTGAGAGG + Intronic
982751948 4:159172649-159172671 CATGCTACTTCCTCTGTAAGTGG + Intronic
983432957 4:167674472-167674494 CTTGCTGCTTCCACTGTATGAGG - Intergenic
984078397 4:175212967-175212989 CATGCTGCTTACTCTATAAGTGG + Intergenic
984080791 4:175247071-175247093 CGTGCTGTTTCCTATGTAAGAGG + Intergenic
985879691 5:2628830-2628852 CATGCTGCTTCCTCTCTCAGTGG + Intergenic
988630874 5:32930171-32930193 CATGCTTCTTGTTGTGTAAGAGG + Intergenic
991028532 5:62057768-62057790 CAGGCAACTTCCTCTGAGAGGGG + Intergenic
992723924 5:79587703-79587725 TCTGTTATTTCCTCTGTAAGAGG - Intergenic
993296982 5:86153281-86153303 CCTGCTACAGCATCTGTAAGGGG + Intergenic
993728876 5:91398981-91399003 CATTCTCCTTCTTCTGTAAACGG - Intergenic
994209218 5:97069610-97069632 CATGCTGTTTCCTCACTAAGTGG + Intergenic
994821160 5:104652733-104652755 TATGCTACTCCCACTGAAAGTGG + Intergenic
999501750 5:152153802-152153824 CATGTCACTTCCTCTGTAACTGG - Intergenic
999555114 5:152732364-152732386 CATTCTAATCCCTCAGTAAGTGG - Intergenic
1003144454 6:3498205-3498227 CATGCTGCTTCCTCTGAAAGAGG - Intergenic
1004647139 6:17573568-17573590 CATGCTCCCACTTCTGTAAGGGG - Intergenic
1006439538 6:34045380-34045402 CTTGCTACCTCCCCTGTGAGGGG - Intronic
1010650387 6:78447770-78447792 AATGCTTCTTTTTCTGTAAGCGG + Intergenic
1012090625 6:94889990-94890012 AACACTACTTTCTCTGTAAGTGG - Intergenic
1012703235 6:102489933-102489955 ACTTCTACTTCCTCTGTAACTGG - Intergenic
1017090214 6:150752714-150752736 AATCCTCCTTACTCTGTAAGGGG + Intronic
1022877927 7:34553703-34553725 CATGCTACTTCTCCAGTAAGGGG + Intergenic
1023591370 7:41783874-41783896 CATCCTACATCCTCTGTAGATGG + Intergenic
1026664994 7:72334531-72334553 GATGCCCTTTCCTCTGTAAGGGG - Intronic
1028254542 7:88577799-88577821 CAATCTACTTCCTCTGTGAAAGG - Intergenic
1029046780 7:97638568-97638590 CATGCTACTTTTTCATTAAGAGG + Intergenic
1029498103 7:100908910-100908932 CCTTCAACTTCCCCTGTAAGTGG + Intergenic
1032850265 7:135789091-135789113 CATGGTACGTCCTGTGAAAGGGG - Intergenic
1034869542 7:154671779-154671801 GTTGCTACTTATTCTGTAAGAGG - Intronic
1035914096 8:3599896-3599918 AATGTTGCTTCCTCTGGAAGGGG - Intronic
1036610281 8:10344098-10344120 CATGCAACTTCCTTAGCAAGAGG - Intronic
1038379919 8:27083178-27083200 CATGCTAATTCTGCTGTCAGAGG + Intergenic
1041831457 8:62159681-62159703 AATGCTGCAGCCTCTGTAAGTGG - Intergenic
1043888239 8:85627345-85627367 AATGCTACTGCCTTTGTATGTGG - Intergenic
1045598157 8:103681275-103681297 CATGGTACTTACTATGTAACAGG - Intronic
1046784679 8:118253056-118253078 CATTCTCCTACCTCTTTAAGGGG - Intronic
1048550527 8:135429332-135429354 CTTGCTTTTTCCCCTGTAAGAGG - Intergenic
1049129423 8:140824303-140824325 CATGCTGCTTTTTCTGTAGGCGG + Intronic
1052763437 9:32616512-32616534 CATGCTGCTTCGTCTTAAAGAGG + Intergenic
1059539694 9:115118188-115118210 CGAGCTCCTTCCTCTGTAATGGG + Exonic
1062477439 9:136735786-136735808 CATGCCACTGCCTCTGAAATGGG + Intergenic
1187778270 X:22788216-22788238 CATTATATTTCCTCTTTAAGAGG - Intergenic
1192007145 X:67228371-67228393 CAAGTTACTTAATCTGTAAGTGG + Intergenic
1192047757 X:67694561-67694583 CATGCTGCTTCCTATGTTAGAGG + Intronic
1193611197 X:83633205-83633227 CATGCTACATTCTATGTAAATGG - Intergenic
1194572746 X:95573767-95573789 CATACTAATATCTCTGTAAGTGG - Intergenic
1197462519 X:126760084-126760106 CAAGCTAGGTACTCTGTAAGAGG - Intergenic
1198077824 X:133211510-133211532 TATGCTACTTCATCAATAAGTGG + Intergenic
1199108051 X:143895396-143895418 CCTCCTTCTTCCTCTGTAAATGG - Intergenic
1199575630 X:149311409-149311431 CATGCTTCCCCCACTGTAAGGGG - Intergenic