ID: 982753553

View in Genome Browser
Species Human (GRCh38)
Location 4:159191495-159191517
Sequence CTGTGGGAGGCCAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982753544_982753553 11 Left 982753544 4:159191461-159191483 CCGGGCGCGATGGCTAATGCCTG 0: 2
1: 328
2: 9788
3: 64722
4: 135303
Right 982753553 4:159191495-159191517 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
982753547_982753553 -8 Left 982753547 4:159191480-159191502 CCTGTAATCCCAGCACTGTGGGA 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
Right 982753553 4:159191495-159191517 CTGTGGGAGGCCAAGGTGGACGG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982753553 Original CRISPR CTGTGGGAGGCCAAGGTGGA CGG Intronic
Too many off-targets to display for this crispr