ID: 982757974

View in Genome Browser
Species Human (GRCh38)
Location 4:159247234-159247256
Sequence GGGACAGACCTGAAACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 564}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982757974_982757979 10 Left 982757974 4:159247234-159247256 CCACCATGTTTCAGGTCTGTCCC 0: 1
1: 0
2: 1
3: 28
4: 564
Right 982757979 4:159247267-159247289 GATATAAAAGTCAACAACACAGG 0: 1
1: 0
2: 0
3: 27
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982757974 Original CRISPR GGGACAGACCTGAAACATGG TGG (reversed) Intronic
900528272 1:3139873-3139895 GGGACAGCTCTGAACCAGGGAGG - Intronic
900894605 1:5474529-5474551 GGGACAGGGCTGAAAGAAGGAGG - Intergenic
901154471 1:7126145-7126167 GGGAGATACCTGAATCATGGGGG - Intronic
901176440 1:7302829-7302851 CGCACAGGTCTGAAACATGGTGG - Intronic
903674938 1:25057626-25057648 AGGACAGACCTGAGTCATTGAGG + Intergenic
904856607 1:33502503-33502525 GGGAGGTACCTGAATCATGGGGG + Intergenic
905351478 1:37349544-37349566 GGGAGATAACTGAATCATGGAGG + Intergenic
905442584 1:38004909-38004931 TGGACAGACCCGAGGCATGGGGG - Intronic
906256683 1:44355740-44355762 GGGGGAGACCTGAGACAAGGAGG + Intergenic
907280014 1:53341223-53341245 GGGAGGGACGTGAATCATGGGGG + Intergenic
907299532 1:53477868-53477890 GGGGCAGCCCTTAACCATGGAGG - Intergenic
907343889 1:53758479-53758501 GGGAGATAACTGAATCATGGGGG - Intergenic
907584704 1:55606946-55606968 GGAACAGACCTGGAACATGTTGG - Intergenic
907700138 1:56778184-56778206 GGGACAGAGGTGAGACCTGGTGG - Intronic
914876991 1:151519379-151519401 GGGTCTGACCTGCAGCATGGTGG - Exonic
914878727 1:151531241-151531263 GGGAAAGAGCAAAAACATGGAGG - Intronic
915146023 1:153796191-153796213 GGGACAGACCTAGAGGATGGGGG - Intergenic
916199230 1:162254352-162254374 GGGACTGACATGAACCATTGTGG + Intronic
917160433 1:172051308-172051330 GGGAGTGACCTGGAACTTGGTGG - Intronic
917681698 1:177374615-177374637 GGGAGATAATTGAAACATGGGGG - Intergenic
917759095 1:178135913-178135935 GGGAGATAACTGAATCATGGGGG - Intronic
917838591 1:178959690-178959712 GGGAAATACCTGAATCATGGGGG + Intergenic
917895198 1:179480427-179480449 GGGAGATAACTGAATCATGGGGG - Intronic
918202202 1:182278117-182278139 GGGAGATAATTGAAACATGGGGG - Intergenic
918493579 1:185109486-185109508 GGGACAGACCTGAATTTTGAGGG - Intergenic
919133236 1:193476882-193476904 GGGAGATAACTGAATCATGGGGG + Intergenic
919457741 1:197839923-197839945 GGGAGATACTTGAATCATGGCGG + Intergenic
919490782 1:198202776-198202798 GGGAAATAACTGAATCATGGGGG - Intronic
919593451 1:199532648-199532670 GGGAGATAACTGAATCATGGGGG + Intergenic
920569774 1:207007994-207008016 GGGAGATAACTGAATCATGGGGG - Intronic
921362522 1:214343046-214343068 GGGACATAATTGAATCATGGGGG + Intergenic
921584847 1:216934675-216934697 GGGAGATAACTGAATCATGGAGG - Intronic
921933926 1:220778529-220778551 GGGACAGAATTCAATCATGGGGG - Intronic
922636492 1:227178227-227178249 GGGAGATAACTGAATCATGGGGG + Intronic
922963549 1:229668281-229668303 GGGAGACAACTGAATCATGGAGG - Intergenic
923411055 1:233709482-233709504 GGGAGAGTCAGGAAACATGGAGG - Intergenic
923411354 1:233713131-233713153 GGGAGACAACTGAATCATGGGGG + Intergenic
923447183 1:234082833-234082855 GGGAGATAACTGAATCATGGGGG - Intronic
923459439 1:234195776-234195798 GGGAGACAACTGAATCATGGGGG + Intronic
923892018 1:238226614-238226636 GGGAGAAAACTGAATCATGGGGG - Intergenic
923935984 1:238760887-238760909 GGGAGATAACTGAATCATGGTGG - Intergenic
923987923 1:239402372-239402394 GGGAAAGACCTGGATCAAGGAGG - Intronic
924193346 1:241579000-241579022 GGGACATAATTGAATCATGGGGG - Intronic
924220276 1:241867421-241867443 GGGAGATAACTGAATCATGGTGG - Intronic
924804338 1:247350314-247350336 GGGAGATAACTGAATCATGGGGG + Intergenic
1063571278 10:7216302-7216324 GGGAGATAACTGAATCATGGGGG + Intronic
1063577067 10:7271901-7271923 GGGAAATAACTGAATCATGGGGG - Intronic
1063833468 10:9984069-9984091 GGGAGATAATTGAAACATGGGGG + Intergenic
1064402009 10:15029368-15029390 GGGAAATAACTGAATCATGGGGG - Intergenic
1064425312 10:15224566-15224588 GGGAGATAACTGAATCATGGCGG + Intronic
1066279737 10:33904513-33904535 GGGAAATAACTGAATCATGGGGG - Intergenic
1067099752 10:43326002-43326024 GGGACAGCCCTGAAAAACAGTGG - Intergenic
1067363805 10:45606505-45606527 GGGAGATAACTGAATCATGGGGG + Intergenic
1067554915 10:47262081-47262103 GGGGCATACCTGCAACATGCTGG + Intergenic
1068011246 10:51454767-51454789 GGGAGATAACTGAATCATGGTGG - Intronic
1068102676 10:52575466-52575488 GGGAGAAACCTGAAATATGATGG - Intergenic
1068220596 10:54040267-54040289 GGGAGATAACTGAATCATGGGGG + Intronic
1070376151 10:75832880-75832902 GGGAGACAACTGAATCATGGGGG - Intronic
1070634407 10:78112738-78112760 GGAGCAGAGCTGAAAAATGGAGG + Intergenic
1071013848 10:80971251-80971273 GGGACATCCCTGAAACACAGTGG - Intergenic
1071818147 10:89253469-89253491 GGGAGATAACTGAATCATGGGGG - Intronic
1072130247 10:92487140-92487162 GGGACAGACCTAATACATGGGGG - Intronic
1072207828 10:93220742-93220764 AGGACAGACCAGAAACATCCGGG + Intergenic
1072538877 10:96383394-96383416 GGGAGAGAATTGAATCATGGAGG + Intronic
1072643107 10:97228885-97228907 TGGACAGACAGGACACATGGGGG - Intronic
1073799355 10:107024458-107024480 GGGACATATCTGGATCATGGGGG - Intronic
1074686070 10:115963535-115963557 AGGACAGGCCTGGCACATGGTGG + Intergenic
1075270678 10:121047435-121047457 GGGAGATAACTGAATCATGGGGG + Intergenic
1076668342 10:132105298-132105320 GGAACTGACCTGAAACAGAGTGG + Intronic
1076772046 10:132671151-132671173 GGGACACTCCTGACAGATGGAGG - Intronic
1077793880 11:5470465-5470487 GGCACAGAGCAGAGACATGGAGG - Intronic
1078069054 11:8096406-8096428 GGGACTGAGCTGAAACTGGGTGG + Intronic
1078373795 11:10775762-10775784 GGGACAGACTTGAAAATTGGAGG + Intronic
1078423179 11:11228895-11228917 GGCATATACCTGAAACATGGAGG - Intergenic
1079176319 11:18144682-18144704 GGGAGATAACTGAATCATGGGGG - Intronic
1079686137 11:23362340-23362362 GGGAGATAACTGAATCATGGGGG - Intergenic
1080073932 11:28125592-28125614 GTGAGAGACCTGTAACATTGCGG - Intronic
1080243583 11:30154871-30154893 GAGACAGACAAGAAACATGTTGG - Intergenic
1080563240 11:33483654-33483676 GGGAGATAACTGAATCATGGGGG + Intergenic
1080768743 11:35321198-35321220 GGGAGATAACTGAATCATGGGGG - Intronic
1081281119 11:41210294-41210316 GGGAGATAACTGAATCATGGGGG + Intronic
1082990121 11:59200247-59200269 GGGAGATAACTGAATCATGGGGG - Intronic
1083264012 11:61537808-61537830 GGGACAGAGATGAAAGATGGAGG + Intronic
1085249926 11:75136198-75136220 GGGAGATAACTGAATCATGGAGG + Intronic
1086309191 11:85517833-85517855 GGGAGATAACTGAATCATGGAGG + Intronic
1086885965 11:92205816-92205838 GGGAGATAACTGAATCATGGGGG + Intergenic
1088705674 11:112462007-112462029 GGGAGATACTTGAATCATGGGGG + Intergenic
1088736643 11:112733036-112733058 GGGAGATAATTGAAACATGGGGG + Intergenic
1089044250 11:115485520-115485542 GGGAGACAACTGAATCATGGGGG + Intronic
1089512230 11:119006794-119006816 GGGAGATAACTGAATCATGGGGG + Intronic
1091937905 12:4447913-4447935 GAGACAGTCCAGAAACATGTTGG + Intergenic
1092899907 12:13048977-13048999 GGGAGATAACTGAATCATGGGGG - Intronic
1093141997 12:15519274-15519296 GGGAGATAACTGAATCATGGGGG - Intronic
1095744284 12:45640244-45640266 GGGAGATAACTGAATCATGGGGG - Intergenic
1098109014 12:67102190-67102212 GGGAGATAACTGAATCATGGGGG - Intergenic
1098317416 12:69207266-69207288 GGGAGATATTTGAAACATGGGGG - Intergenic
1098840857 12:75476268-75476290 GGGAGAGAATTGAATCATGGGGG - Intergenic
1098958263 12:76710201-76710223 GAGACAAACATGAAACAAGGAGG - Intergenic
1099156325 12:79180894-79180916 GGGAGATAACTGAATCATGGGGG + Intronic
1099570778 12:84315258-84315280 GGGAGATAACTGAATCATGGGGG - Intergenic
1100091439 12:90976769-90976791 GGGAGATAACTGAATCATGGGGG + Intronic
1100325059 12:93532617-93532639 GGGAGATACTTGAATCATGGGGG - Intergenic
1100448238 12:94680869-94680891 GGGAGATAACTGAATCATGGGGG + Intergenic
1100928277 12:99575672-99575694 GGGAGATAACTGAATCATGGGGG - Intronic
1101861401 12:108485281-108485303 GGGAGATAACTGAATCATGGGGG + Intergenic
1102148575 12:110672704-110672726 GGGAGGTAACTGAAACATGGGGG + Intronic
1102192185 12:110997006-110997028 GGGAGATAACTGAATCATGGGGG + Intergenic
1102869523 12:116402625-116402647 GGGACATGACTGAATCATGGGGG + Intergenic
1102891844 12:116565473-116565495 GGGAGATAACTGAATCATGGGGG - Intergenic
1103077934 12:117999885-117999907 GGGAGATAACTGAATCATGGGGG + Intergenic
1103403047 12:120656104-120656126 GGAACAGACCAGCTACATGGTGG + Intronic
1103472257 12:121191271-121191293 GGGAGAGAATTGAATCATGGGGG + Intergenic
1104212303 12:126700656-126700678 GGGAGAGAATTGAATCATGGGGG + Intergenic
1104413965 12:128582546-128582568 GGGAGATAACTGAATCATGGGGG + Intronic
1105650410 13:22371462-22371484 GGGACATAATTGAATCATGGGGG - Intergenic
1105774429 13:23644316-23644338 GGGAGATAACTGAATCATGGGGG + Intronic
1106280784 13:28267784-28267806 GGGAGATAACTGAATCATGGGGG - Intronic
1106888451 13:34216243-34216265 GGGAGATAACTGAATCATGGGGG - Intergenic
1106898053 13:34326455-34326477 GGGAGATAACTGAATCATGGGGG + Intergenic
1107543562 13:41416115-41416137 GGGAGATAACTGAATCATGGGGG - Intergenic
1107576688 13:41731716-41731738 GGGAGATAACTGAATCATGGGGG + Intronic
1107589236 13:41884242-41884264 GGGAGACAACTGAATCATGGAGG + Intronic
1107741567 13:43455717-43455739 GGGAGACACTTGAATCATGGGGG + Intronic
1107964034 13:45583634-45583656 GGGAGATAACTGAATCATGGGGG + Intronic
1108175627 13:47790033-47790055 AGGACATAACTGAATCATGGGGG + Intergenic
1108936655 13:55890680-55890702 GGGAGATAACTGAATCATGGGGG - Intergenic
1109470640 13:62799487-62799509 GGGGAAGGCCTGAAGCATGGGGG + Intergenic
1109633040 13:65078300-65078322 GGGACATAGTTGAATCATGGGGG + Intergenic
1110420763 13:75305035-75305057 GGGACATAATTGAATCATGGGGG + Intronic
1111036041 13:82676467-82676489 GGGAAATACTTGAATCATGGGGG - Intergenic
1112253224 13:97803003-97803025 GGGAGATAACTGAATCATGGGGG + Intergenic
1112786127 13:102953513-102953535 GGGACAGACACGGAAGATGGAGG + Intergenic
1113064307 13:106358248-106358270 GGGAGATAACTGAATCATGGGGG + Intergenic
1113151008 13:107263522-107263544 GGGAGATAACTGAATCATGGGGG + Intronic
1114976540 14:28107571-28107593 GCGACAGACTTAAAACATGTAGG - Intergenic
1115021408 14:28685007-28685029 GGGACATAACTGAATCATGGGGG + Intergenic
1115078386 14:29419209-29419231 GTGACAGACCTTAACCATAGGGG - Intergenic
1115085661 14:29512476-29512498 GGGAGATAACTGAATCATGGGGG - Intergenic
1115143233 14:30197893-30197915 GGGAAATAACTGAATCATGGGGG + Intergenic
1115157759 14:30359946-30359968 GGGAGACAACTGAATCATGGGGG - Intergenic
1115817546 14:37179055-37179077 GGGAGATAACTGAATCATGGGGG - Intergenic
1115820451 14:37207181-37207203 GGGAGATACTTGAATCATGGGGG + Intronic
1116302633 14:43204534-43204556 GGGACATAACTGAATCCTGGGGG - Intergenic
1117427772 14:55619715-55619737 GGGACATAATTGAATCATGGGGG - Intronic
1117752108 14:58935229-58935251 GGGACATAGTTGAATCATGGGGG - Intergenic
1117885799 14:60361447-60361469 GGGAGATAACTGAATCATGGGGG + Intergenic
1118419244 14:65582445-65582467 GGCACAGACATGAAGCATAGTGG - Intronic
1118677625 14:68205396-68205418 GGGATAGATATGAAACATGAAGG + Intronic
1119017063 14:71069187-71069209 GGGAGATAGCTGAATCATGGGGG - Intronic
1120312673 14:82850825-82850847 GGGACATAATTGAATCATGGGGG + Intergenic
1120718113 14:87862117-87862139 GGGAGAGACTGGAAAAATGGAGG - Intronic
1120829702 14:88987061-88987083 GGGAGAGAACTGAATCATGAGGG - Intergenic
1122386072 14:101349176-101349198 AGGGAAGACCTGAAGCATGGGGG - Intergenic
1123844063 15:24279550-24279572 TGGACAAAACTGAATCATGGGGG - Intergenic
1123859141 15:24445835-24445857 TGGACAAAACTGAATCATGGGGG - Intergenic
1127278503 15:57468788-57468810 GGGAGATAACTGAATCATGGGGG + Intronic
1128119918 15:65138203-65138225 GGGAAATAACTGAATCATGGGGG - Intergenic
1128619443 15:69136578-69136600 GGGAGATAACTGAATCATGGGGG - Intergenic
1131057662 15:89385201-89385223 GTGACAGACCAGCAAGATGGGGG - Intergenic
1131080918 15:89534451-89534473 GGGACATAATTGAATCATGGGGG - Intergenic
1131296415 15:91153422-91153444 GTCACAGACCTAAAACGTGGTGG - Intronic
1132122930 15:99193366-99193388 GGGAGATAACTGAATCATGGGGG + Intronic
1132781162 16:1626471-1626493 GGGAAAGCCCTGAAACAAGAGGG - Intronic
1133473398 16:6097032-6097054 GGGAGATAACTGAATCATGGGGG + Intronic
1134066445 16:11231578-11231600 GGGTCAGTCCTGAAACAAGGAGG - Intergenic
1134232500 16:12439627-12439649 GGGAAATAACTGAATCATGGGGG - Intronic
1134233795 16:12449964-12449986 GGGAGACAACTGAATCATGGGGG + Intronic
1134334343 16:13283617-13283639 GGGAGATAACTGAATCATGGGGG - Intergenic
1134415373 16:14039014-14039036 GGGAGATAACTGAATCATGGGGG - Intergenic
1135243059 16:20827642-20827664 TGGACAGAACTGAACCATGAAGG + Intronic
1135731378 16:24897830-24897852 GGGAGATAACTGAATCATGGGGG - Intronic
1136014858 16:27389907-27389929 GGGAGATAACTGAATCATGGGGG - Intergenic
1136287062 16:29250571-29250593 GGGAGAAAACTGAACCATGGGGG + Intergenic
1136642876 16:31581534-31581556 GGGACATAATTGAATCATGGGGG - Intergenic
1137931919 16:52596814-52596836 GGGAGAGAAATGAATCATGGGGG - Intergenic
1139124246 16:64058637-64058659 GGGAGATAATTGAAACATGGAGG - Intergenic
1139510552 16:67425997-67426019 GGGATAGCTCTGAAAAATGGTGG + Intergenic
1139736133 16:68990455-68990477 GGGAGATAACTGAATCATGGGGG - Intronic
1140873854 16:79131999-79132021 GGGAGACAACTGAATCATGGGGG - Intronic
1141466434 16:84208745-84208767 GGGAGATAACTGAATCATGGGGG + Intergenic
1141851562 16:86649762-86649784 AGAACAAACATGAAACATGGGGG - Intergenic
1141909596 16:87049644-87049666 GGGAGATAACTGAATCATGGGGG - Intergenic
1141979926 16:87543855-87543877 GGGAAAGACCTGAAACTTCGTGG - Intergenic
1142092666 16:88223203-88223225 GGGAGAAAACTGAACCATGGGGG + Intergenic
1144192449 17:12858988-12859010 GGGAGAGAATTGAATCATGGGGG - Intronic
1145823453 17:27858322-27858344 GGGAGATAACTGAATCATGGGGG + Intronic
1146579137 17:34021419-34021441 GGGCCAGACCTGATAACTGGTGG - Intronic
1146697220 17:34918854-34918876 GGGAGATAACTGAATCATGGGGG + Intergenic
1146988954 17:37249872-37249894 GGGAGATACTTGAATCATGGGGG + Intronic
1148230450 17:45930058-45930080 GGGACAGAGCCAAAGCATGGTGG - Intronic
1148392604 17:47283571-47283593 GGGAGAGACCTGAAGCAGGTGGG + Intronic
1148445053 17:47732668-47732690 GGGGCAGACCTGGAACCTGATGG - Intergenic
1148735046 17:49860568-49860590 GGGCCAGGCCTGAGTCATGGGGG - Intergenic
1148783187 17:50133028-50133050 GTCAGAGACCTGAAGCATGGAGG - Intergenic
1149902188 17:60490709-60490731 GGGAGATAACTGAATCATGGGGG + Intronic
1150529559 17:65962677-65962699 GGGAGATAACTGAATCATGGGGG + Intronic
1150670995 17:67197134-67197156 GGGAGATAACTGAATCATGGGGG + Intronic
1151039619 17:70843462-70843484 GGGACTGACCTGAGACCTTGTGG - Intergenic
1151040003 17:70848457-70848479 GGGAGATAACTGAATCATGGGGG - Intergenic
1151498737 17:74475268-74475290 GGGAGATAACTGAATCATGGGGG - Intronic
1151896276 17:76982907-76982929 GGGACAGACATAAAACCTTGGGG + Intergenic
1151904055 17:77036185-77036207 GGGACAACCCTGGAACACGGAGG - Intergenic
1153776425 18:8458277-8458299 GGGACACGCCTTAAACCTGGGGG - Intergenic
1154284083 18:13035518-13035540 GGGAGATAACTGAAACATGGAGG - Intronic
1155304251 18:24463694-24463716 GGGCCAGTTCTGAAACCTGGGGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155537007 18:26828891-26828913 GGGACAGACCTAAACCATGCGGG + Intergenic
1155537043 18:26829101-26829123 GAGACAGACCTAAACCATGCAGG + Intergenic
1155537064 18:26829214-26829236 GAGACAGACCTGAACCATGTGGG + Intergenic
1155537085 18:26829358-26829380 GAGACAGACCTAAACCATGCGGG + Intergenic
1155537115 18:26829520-26829542 GAGACAGACCTAAACCATGCAGG + Intergenic
1155537136 18:26829633-26829655 GAGACAGACCTGAACCATGTGGG + Intergenic
1155537157 18:26829777-26829799 GAGACAGACCTAAACCATGCGGG + Intergenic
1155597368 18:27503040-27503062 TGGACACACCTGAAGCCTGGAGG + Intergenic
1156009406 18:32479070-32479092 GGGAAAGACAAGAAAGATGGTGG + Intergenic
1156238553 18:35228739-35228761 GGGAGGTAACTGAAACATGGGGG + Intergenic
1156358939 18:36367077-36367099 GGGTCAGAACTGAAACATGCAGG + Intronic
1157370820 18:47109701-47109723 GGGTCTGACCTGAAGCATGAAGG - Intronic
1158102395 18:53843749-53843771 GGGACAGAGCTGGAAGATGGAGG - Intergenic
1159282794 18:66309653-66309675 GGGACATAATTGAATCATGGGGG - Intergenic
1159534605 18:69700088-69700110 GGGAGATAACTGAATCATGGGGG - Intronic
1160335850 18:78038590-78038612 AGAAGAGACCTGAAACACGGTGG - Intergenic
1160464565 18:79065495-79065517 GGGAGATAACTGAATCATGGGGG + Intergenic
1160612703 18:80100898-80100920 GGGAGAGAATTGAATCATGGGGG + Intergenic
1161173845 19:2828051-2828073 GGGAGATAACTGAATCATGGCGG - Intronic
1161262598 19:3346086-3346108 GGGACTGATCTGGAACATGGAGG - Intergenic
1162867708 19:13561462-13561484 GGGAGATAACTGAATCATGGGGG - Intronic
1164486545 19:28660902-28660924 GGGAGAAAACTGAATCATGGGGG + Intergenic
1167087620 19:47320943-47320965 GGGAAAGACAGGCAACATGGAGG - Exonic
1167323265 19:48809414-48809436 GGGACAGTCCTGGAGTATGGAGG - Intronic
1167479721 19:49722421-49722443 GGGAGATACTTGAATCATGGGGG + Intergenic
1168132040 19:54327566-54327588 GGGAGATAACTGAATCATGGAGG - Intergenic
1168451774 19:56471929-56471951 GGGAGATAACTGAATCATGGGGG + Exonic
1168496355 19:56854679-56854701 GGGAGATAGCTGAATCATGGGGG + Intergenic
925273826 2:2635167-2635189 AGGACACAGCTGAACCATGGCGG - Intergenic
925569372 2:5292622-5292644 GGGACATAATTGAATCATGGGGG + Intergenic
925638153 2:5961789-5961811 GGGAGATAACTGAATCATGGGGG + Intergenic
925849223 2:8064825-8064847 GGGATAGAGTTGAATCATGGGGG - Intergenic
926080079 2:9978085-9978107 GGGAGATAACTGAATCATGGGGG - Intronic
926304170 2:11626046-11626068 GGGAGATAACTGAATCATGGGGG - Intronic
926307295 2:11647514-11647536 GGGAGACAACTGAATCATGGGGG + Intergenic
926371343 2:12181827-12181849 GGGACACAGCTGAAGCATGTGGG + Intergenic
926889212 2:17625015-17625037 GGGAGATAACTGAATCATGGGGG + Intronic
926983545 2:18596927-18596949 GGGAGATAACTGAATCATGGAGG - Intergenic
927245530 2:20954595-20954617 GGGAGAAACTTGAATCATGGGGG - Intergenic
927428244 2:23004979-23005001 AGAACAGACCTGAGACTTGGGGG + Intergenic
927438345 2:23089781-23089803 GGGAGATAACTGAATCATGGGGG - Intergenic
927461602 2:23304148-23304170 GGGAGACAACTGAATCATGGGGG - Intergenic
927672280 2:25078842-25078864 GCCACAGACCTGACACCTGGCGG - Intronic
928453554 2:31399657-31399679 GGGAGATAACTGAATCATGGGGG + Intronic
928878456 2:36069117-36069139 GGGAGATAACTGAATCATGGGGG - Intergenic
929862956 2:45694827-45694849 AGGACAAACCTGAAATGTGGAGG + Intronic
930258894 2:49122593-49122615 GGGAGAGACTTGTAACAGGGAGG - Intronic
931567696 2:63632169-63632191 GGGAAAGACCTTCAACAAGGCGG - Intronic
931839353 2:66132170-66132192 GAGGCAGACCTGGAGCATGGTGG + Intergenic
932737997 2:74269010-74269032 GGTGAAGACCTGAAACATGGGGG + Intronic
933716335 2:85363848-85363870 GGGACATAATTGAATCATGGGGG - Intronic
934940530 2:98498231-98498253 GGGAGATAACTGAATCATGGGGG + Intronic
935244953 2:101210543-101210565 GGGAGATAACTGAATCATGGGGG + Intronic
935409119 2:102740296-102740318 GGGACATAATTGAATCATGGAGG + Intronic
936405253 2:112197015-112197037 GGGAGATAACTGAATCATGGGGG - Intergenic
936521861 2:113216493-113216515 GGGACACAGCTGGAACAAGGGGG - Exonic
937106602 2:119321597-119321619 GGGAGAGAATTGAATCATGGGGG - Intronic
937345043 2:121120283-121120305 GGGAGACAACTGAATCATGGGGG - Intergenic
937702812 2:124882954-124882976 GGGAGAGAATTGAATCATGGAGG - Intronic
939225703 2:139361479-139361501 GTCACAGAACTAAAACATGGTGG + Intergenic
939227532 2:139382915-139382937 GGGACAGAACTGAAAAATTCTGG + Intergenic
940033964 2:149293904-149293926 GGGACAGTATTTAAACATGGTGG + Intergenic
940888711 2:159014383-159014405 GGGAGATAACTGAATCATGGGGG - Intronic
941837776 2:170045282-170045304 GGGAGATAACTGAATCATGGGGG - Intronic
942118037 2:172748534-172748556 GGGAGATAACTGAATCATGGGGG - Intronic
942185429 2:173420806-173420828 GGGAGACACATGAATCATGGGGG - Intergenic
942204342 2:173604582-173604604 GGGAGATAACTGAATCATGGGGG - Intergenic
942207907 2:173640689-173640711 GGGACAAACTTTAAACATGGAGG - Intergenic
942424090 2:175841071-175841093 GGGAGATAACTGAATCATGGGGG - Intergenic
942935157 2:181546952-181546974 GGGAGATAACTGAATCATGGGGG + Intronic
943156724 2:184188659-184188681 GGGATATAACTGAATCATGGGGG - Intergenic
943251070 2:185522392-185522414 GGGACATAACTGAATCGTGGAGG + Intergenic
943804771 2:192110836-192110858 GGGAGATAACTGAATCATGGGGG + Intronic
945145777 2:206736554-206736576 GGGAGATAACTGAAACATGGGGG - Intergenic
945635357 2:212342309-212342331 GGGAGATAACTGAATCATGGGGG + Intronic
946137930 2:217663567-217663589 GGCACAGCCCTGAGACAAGGAGG + Intronic
946519003 2:220446181-220446203 GGGAGATAACTGAATCATGGGGG + Intergenic
946562603 2:220929412-220929434 GGGAGGGAACTGAATCATGGGGG - Intergenic
946585887 2:221187295-221187317 GAGAGAGACCTGAAAAGTGGAGG + Intergenic
946892747 2:224295176-224295198 GGGAGATAACTGAATCATGGGGG + Intergenic
946896138 2:224326329-224326351 GAGACAGACATAAAAAATGGAGG + Intergenic
946970812 2:225089106-225089128 GGGAGATACTTGAATCATGGGGG - Intergenic
947611509 2:231527665-231527687 AGGAGAGACCTGAGACCTGGAGG + Intronic
948038196 2:234876696-234876718 GGGAGATACTTGAATCATGGGGG + Intergenic
948758403 2:240173145-240173167 GGGAGATACTTGAATCATGGAGG - Intergenic
1170866799 20:20164995-20165017 GGGAGATAACTGAATCATGGGGG - Intronic
1171080496 20:22177626-22177648 GGGACAGTCTTGCAACCTGGGGG + Intergenic
1171971743 20:31569244-31569266 GGGCCAGACCAGACAGATGGGGG + Exonic
1172380289 20:34484050-34484072 GGGAGATAACTGAATCATGGGGG - Intronic
1172839362 20:37892882-37892904 GGCACAGACAAGTAACATGGAGG + Intergenic
1173254341 20:41383247-41383269 AGGAGACAACTGAAACATGGGGG + Intergenic
1174293339 20:49524823-49524845 GGGAGATAACTGAATCATGGGGG - Intronic
1174920508 20:54696897-54696919 GGGAGATAACTGAATCATGGTGG + Intergenic
1175017824 20:55810723-55810745 GGGAGATAACTGAATCATGGGGG + Intergenic
1175830696 20:61964097-61964119 GGGAGGTACCTGAATCATGGGGG - Intronic
1175981782 20:62742373-62742395 GGGACACGCCTGACTCATGGTGG - Intronic
1176093059 20:63327454-63327476 GGGACAGACGTGGGAGATGGGGG + Intronic
1176687431 21:9863154-9863176 GGGACATAATTGAATCATGGAGG + Intergenic
1177430407 21:20985438-20985460 TGGACATACTTGAATCATGGGGG - Intergenic
1177945931 21:27469796-27469818 GGGAGACAACTGAATCATGGAGG + Intergenic
1178094484 21:29198959-29198981 GGGAGACACTTGAATCATGGGGG - Intronic
1178128409 21:29542206-29542228 GGGACACACCACAAGCATGGAGG - Intronic
1178260322 21:31093767-31093789 GGGAGATAACTGAATCATGGGGG + Intergenic
1178563515 21:33661688-33661710 GGGAGATAACTGAATCATGGGGG + Intronic
1179101775 21:38360673-38360695 GGGACATACTTGAATCATGGGGG + Intergenic
1179259733 21:39747321-39747343 GGGAGATAACTGAATCATGGCGG - Intronic
1179448769 21:41453259-41453281 GGGAGATAACTGAATCATGGGGG - Intronic
1179781467 21:43703537-43703559 GGCCCAGACCTGCCACATGGAGG + Intergenic
1180008138 21:45032804-45032826 GGGAAGGAGCTGAGACATGGGGG - Intergenic
1180178947 21:46109445-46109467 GGGGCAGGCCTGAAGCCTGGGGG - Intronic
1181548730 22:23622343-23622365 AGGAAAGACATGAGACATGGAGG + Intronic
1181799938 22:25339701-25339723 AGGAAAGACATGAGACATGGGGG - Intergenic
1184272767 22:43394058-43394080 GTGTGAGACCAGAAACATGGTGG + Intergenic
1185297398 22:50061136-50061158 GGGACAGACCCTAAGCGTGGAGG + Exonic
949745917 3:7291879-7291901 GGGAGATAACTGAATCATGGGGG + Intronic
950133195 3:10561627-10561649 GGGAGATAACTGAATCATGGGGG + Intronic
950190547 3:10973534-10973556 AGGACAGTCCTGAAACTGGGAGG - Intergenic
950435447 3:12976528-12976550 GAGACAGACCTCATACATGAAGG + Intronic
950714560 3:14838503-14838525 GGGATAGACCTGAATCACTGGGG - Intronic
951801869 3:26604859-26604881 GGGAGACAACTGAATCATGGGGG - Intergenic
952462809 3:33547199-33547221 GGGAGATAACTGAATCATGGGGG + Intronic
952548224 3:34446118-34446140 GGGAGATAACTGAAGCATGGGGG + Intergenic
953007061 3:38988421-38988443 GGGAGAGAACTGTAACAAGGAGG - Intergenic
953712640 3:45287546-45287568 GGGAGATAACTGAATCATGGAGG + Intergenic
954478764 3:50777090-50777112 GGGAGATAACTGAATCATGGGGG - Intronic
954900117 3:54011972-54011994 GGGAAACAACTGAATCATGGGGG + Intergenic
955247400 3:57239172-57239194 GGGAGATAACTGAATCATGGGGG - Intronic
955536137 3:59925536-59925558 GGGATAGACCTGGACCCTGGAGG - Intronic
956122667 3:65981653-65981675 GGGAGATAACTGAATCATGGGGG + Intronic
956353620 3:68366164-68366186 GGGAGATAACTGAATCATGGGGG - Intronic
956778343 3:72585173-72585195 GGGAGATAACTGAATCATGGGGG + Intergenic
957305921 3:78458786-78458808 GGGAGATAACTGAATCATGGGGG - Intergenic
957615224 3:82518094-82518116 GGGACATAATTGAATCATGGGGG - Intergenic
957842042 3:85684794-85684816 GGGAGATAACTGAATCATGGGGG - Intronic
959113682 3:102151391-102151413 GGGAGAGAATTGAATCATGGTGG - Intronic
959324737 3:104922310-104922332 GGGAGATAACTGAATCATGGGGG + Intergenic
959389982 3:105761438-105761460 GGGAGATAACTGAATCATGGGGG + Intronic
959609696 3:108279538-108279560 GGGAGAGAATTGAATCATGGGGG - Intergenic
960197077 3:114781737-114781759 GGGAGATAACTGAATCATGGGGG + Intronic
960858533 3:122127756-122127778 GGTTGAGACCTGAAACCTGGGGG - Intergenic
962918823 3:139933681-139933703 GGGACAGCAGTGAATCATGGTGG - Intergenic
963593129 3:147287654-147287676 GGGAGATAACTGAATCATGGGGG - Intergenic
964297734 3:155252347-155252369 GGGACATCCCTGAAAGACGGTGG + Intergenic
964897418 3:161614408-161614430 GGGACAGACATGAATCTTTGGGG - Intergenic
965519560 3:169659148-169659170 GGGACAGACATTCAACATGTAGG - Intronic
965795187 3:172432263-172432285 GGGATATAACTGAATCATGGGGG - Intergenic
965795456 3:172434211-172434233 GGGATATAACTGAATCATGGAGG - Intergenic
965960998 3:174428570-174428592 GGGAAAGACGTGTGACATGGGGG - Intergenic
966148243 3:176836542-176836564 GGGAGATAACTGAATCATGGGGG + Intergenic
966937885 3:184725855-184725877 GGGAGATAACTGAATCATGGGGG + Intergenic
967957460 3:194888302-194888324 GGGAGATAACTGAATCATGGGGG - Intergenic
968710841 4:2116151-2116173 GGGACAGACATCAAAGCTGGGGG - Intronic
969109549 4:4834959-4834981 GGGAGATAACTGAATCATGGGGG - Intergenic
969505393 4:7583545-7583567 GGGAGATAACTGAATCATGGGGG + Intronic
969917204 4:10502397-10502419 GGGAGAGACCTGGATCTTGGGGG - Intronic
970157370 4:13154599-13154621 GGGAGATAACTGAATCATGGGGG - Intergenic
970369492 4:15393041-15393063 GGGACATAACTGAATCATGGGGG + Intronic
970959636 4:21857087-21857109 GGGAAAGGCCTGAAGCCTGGGGG + Intronic
971134643 4:23855007-23855029 GGGACATAACTGAATCGTGGGGG + Intronic
971225254 4:24745919-24745941 GGGAGATAACTGAATCATGGGGG + Intergenic
971506099 4:27367992-27368014 GGGAGAGACTTGAATCATGGGGG - Intergenic
971841337 4:31856167-31856189 GGGACACACCTGAAACAACAGGG + Intergenic
972270441 4:37505718-37505740 GGGAGATAACTGAATCATGGGGG - Intronic
972320762 4:37971506-37971528 GGGAGATAACTGAATCATGGGGG - Intronic
972794923 4:42405855-42405877 GGGACAGATCTGAACCCAGGTGG + Intergenic
972855808 4:43105275-43105297 GGGAGATAACTGAATCATGGGGG + Intergenic
972871213 4:43301042-43301064 GGGACATAATTGAATCATGGGGG - Intergenic
972911801 4:43825810-43825832 GGGACATAATTGAATCATGGGGG - Intergenic
972944429 4:44236825-44236847 GGGAGAGAACTGAATCGTGGGGG + Intronic
973151404 4:46892854-46892876 GGGACATAACTGAATAATGGGGG + Intronic
973598170 4:52513650-52513672 GGGAGGGAACTGAATCATGGGGG + Intergenic
974142794 4:57909009-57909031 GGGAGATAACTGGAACATGGGGG + Intergenic
974396516 4:61343100-61343122 GGGAGATAACTGAATCATGGAGG - Intronic
974725737 4:65795827-65795849 GGGAGATAACTGAATCATGGGGG - Intergenic
975095160 4:70449451-70449473 GGGAGATAACTGAATCATGGGGG - Intronic
975257328 4:72253820-72253842 GGGAGATAACTGAATCATGGGGG + Intergenic
975558429 4:75687215-75687237 GGGAGATAACTGAATCATGGGGG + Intronic
975876057 4:78838246-78838268 GGGAGGTAGCTGAAACATGGGGG - Intronic
976162850 4:82221556-82221578 GGGAGATAACTGAATCATGGGGG + Intergenic
976335332 4:83878931-83878953 GGGAGACACTTGAATCATGGGGG + Intergenic
976986479 4:91305941-91305963 GGGAGATAACTGAATCATGGGGG - Intronic
977033917 4:91924971-91924993 AGGGCAGGCCTGAAACCTGGGGG + Intergenic
978244197 4:106552480-106552502 GGGACATAATTGAATCATGGGGG + Intergenic
978358697 4:107905345-107905367 GGGAAATAACTGAATCATGGGGG - Intronic
979183287 4:117756797-117756819 GGGAGATAACTGAATCATGGGGG + Intergenic
979612406 4:122703241-122703263 GACACAGACCTGAAAGATAGTGG - Intergenic
979612720 4:122706106-122706128 GACACAGACCTGAAAGATAGTGG - Intergenic
979699715 4:123654210-123654232 GGGAGATAACTGAATCATGGGGG + Intergenic
979908231 4:126325214-126325236 GGGAGATAACTGAATCATGGGGG + Intergenic
980893320 4:138837507-138837529 GGGAGATAACTGAATCATGGGGG + Intergenic
982557125 4:156881489-156881511 GGGAGATAACTGAATCATGGAGG + Intronic
982757974 4:159247234-159247256 GGGACAGACCTGAAACATGGTGG - Intronic
983454933 4:167952040-167952062 GGGACATAGTTGAATCATGGAGG + Intergenic
983491886 4:168398556-168398578 GAGAAAGGCCTGAAACCTGGGGG + Intronic
983796446 4:171869732-171869754 GGGAGATAACTGAATCATGGAGG + Intronic
984013325 4:174398242-174398264 GGGAGATAACTGAATCATGGGGG + Intergenic
984065892 4:175047806-175047828 GGGACATAACTGAGTCATGGTGG + Intergenic
984410069 4:179386542-179386564 GGGAGATATCTGAATCATGGGGG - Intergenic
984483622 4:180337470-180337492 GGGAGAGAATTGAATCATGGGGG - Intergenic
984553181 4:181184670-181184692 GGGAAAGAATTGAATCATGGAGG - Intergenic
985814389 5:2115788-2115810 GGGAGATAACTGAATCATGGGGG - Intergenic
986246407 5:6011397-6011419 GGGAGATAACTGAATCATGGGGG - Intergenic
986409710 5:7465097-7465119 GGGAGATAACTGAATCATGGGGG - Intronic
986764115 5:10908219-10908241 GGGAGATAACTGAATCATGGAGG + Intergenic
986805376 5:11303884-11303906 GGGAGATAACTGAATCATGGGGG + Intronic
987208723 5:15656556-15656578 GGGAGATAACTGAATCATGGGGG - Intronic
987252138 5:16110891-16110913 GAGAGAGAACTGAATCATGGGGG + Intronic
987252397 5:16112814-16112836 GGGAGATAACTGAATCATGGAGG + Intronic
987433161 5:17861487-17861509 GGGAAATGCCTGATACATGGCGG - Intergenic
987568774 5:19628085-19628107 GGGAGATACTTGAATCATGGTGG + Intronic
987894480 5:23926690-23926712 GGGAGATAACTGAATCATGGGGG - Intergenic
988202253 5:28083320-28083342 AGGAAAGACCTGAAGCCTGGAGG + Intergenic
988394310 5:30678198-30678220 GGGAGATAACTGAATCATGGGGG + Intergenic
988886536 5:35564039-35564061 GGGAGATAACTGAATCATGGGGG + Intergenic
989479686 5:41915721-41915743 GGGAGATAACTGAATCATGGAGG - Intronic
989608791 5:43272191-43272213 AGGAAAGACCTGAAACATTAGGG - Intronic
989673553 5:43947512-43947534 GGGAGATAACTGAATCATGGGGG - Intergenic
990278690 5:54226868-54226890 GGGAGATAACTGAATCATGGGGG + Intronic
990429002 5:55716528-55716550 GGGAGATAACTGAATCATGGGGG + Intronic
991532821 5:67634525-67634547 GGGAGGTAACTGAAACATGGGGG + Intergenic
992750396 5:79855972-79855994 GGCACAGACTTCAGACATGGTGG + Intergenic
993550730 5:89270588-89270610 GGCACAAACTTGATACATGGTGG - Intergenic
993740206 5:91529536-91529558 GGGAGATAACTGAATCATGGGGG - Intergenic
994386820 5:99142712-99142734 GGGAGATAACTGAATCATGGGGG + Intergenic
994649209 5:102505141-102505163 GGGAGATACTTGAATCATGGGGG + Intergenic
994860124 5:105181923-105181945 GGGACTGACCTGGAGCCTGGAGG - Intergenic
995329725 5:110933617-110933639 GGGACAGAGCAGATACATGCAGG + Intergenic
995477046 5:112558692-112558714 GGGAAACAACTGAATCATGGGGG + Intergenic
996430536 5:123371456-123371478 GGGAGATAATTGAAACATGGGGG - Intronic
997052269 5:130397377-130397399 GGGAGATAACTGAATCATGGGGG + Intergenic
997730947 5:136175185-136175207 GGGAGATAACTGAATCATGGGGG - Intronic
998897228 5:146812907-146812929 GGGATATAACTGAATCATGGGGG - Intronic
1000036729 5:157454435-157454457 GGGACACACCTGAAAAGGGGTGG + Intronic
1000422797 5:161057417-161057439 GGGACATCCCTGAAGGATGGTGG - Intergenic
1001613299 5:173021505-173021527 GGGAGATAACTGAATCATGGGGG - Intronic
1001646449 5:173285309-173285331 GGGAGATAACTGAATCATGGGGG + Intergenic
1002961858 6:1922934-1922956 GGGAGATAACTGAATCATGGGGG + Intronic
1004249509 6:14012079-14012101 GGGAGATAACTGAATCATGGGGG - Intergenic
1004811346 6:19267411-19267433 TGGACAGGCTTGACACATGGGGG - Intergenic
1005113499 6:22312425-22312447 GGAAGATAACTGAAACATGGGGG - Intergenic
1005153723 6:22780247-22780269 GGGAGAGAACTGAACCATGGGGG + Intergenic
1005256986 6:24013850-24013872 GGGAGATGACTGAAACATGGGGG + Intergenic
1008316354 6:50047014-50047036 TGGACAAGCCTGAAACCTGGGGG + Intronic
1009309519 6:62133268-62133290 GGGAGATAACTGAATCATGGGGG + Intronic
1009342913 6:62579988-62580010 GGGAGATAATTGAAACATGGGGG + Intergenic
1009474752 6:64076507-64076529 GGGAGATAACTGAATCATGGGGG + Intronic
1010374316 6:75148887-75148909 GGGAGATAATTGAAACATGGGGG + Intronic
1011253857 6:85401698-85401720 GGGACTGAACTGAAACATACAGG + Intergenic
1011607698 6:89120131-89120153 GGGAGATAACTGAATCATGGGGG - Intergenic
1011746220 6:90410317-90410339 GAGACAGAACTGAGAGATGGGGG - Intergenic
1012037466 6:94160967-94160989 GGGTCAGACCTCAAAAATGCAGG + Intergenic
1013076878 6:106779620-106779642 GGGATATAACTGAATCATGGGGG + Intergenic
1014282597 6:119458276-119458298 GGGACATAATTGAATCATGGGGG + Intergenic
1014406889 6:121063916-121063938 GGGAGATAACTGAATCATGGGGG + Intergenic
1015521503 6:134135928-134135950 GGGAGATAGCTGAACCATGGGGG + Intergenic
1015670922 6:135688726-135688748 GGGAGATAACTGAATCATGGGGG - Intergenic
1015879409 6:137856234-137856256 GGGAGATAACTGAATCATGGGGG + Intergenic
1016202712 6:141431393-141431415 GGGAGATAACTGAATCATGGGGG - Intergenic
1016450665 6:144179237-144179259 GGGAGATAACTGAATCATGGGGG - Intronic
1017741826 6:157413287-157413309 GGGACAGCCCTAAAACACAGAGG + Intronic
1018425763 6:163679143-163679165 GGGACACTTCTGAAACCTGGTGG + Intergenic
1019386783 7:761615-761637 GGGAGGGAACTGAATCATGGGGG - Intronic
1019457915 7:1140536-1140558 GGGACATAATTGAATCATGGGGG + Intergenic
1019522195 7:1466069-1466091 GGGACAGGCCTGACACACAGAGG - Intergenic
1020227808 7:6293940-6293962 GGGAGATAACTGAATCATGGGGG + Intergenic
1020584902 7:10054142-10054164 GGGAGATACTTGAATCATGGGGG + Intergenic
1022080998 7:27021023-27021045 GGGAGATAACTGAATCATGGGGG + Intergenic
1022744115 7:33152036-33152058 AGGACAGAACAGAGACATGGAGG - Intronic
1022803582 7:33799286-33799308 GGAACAGGCCAGAAACCTGGAGG - Intergenic
1023386233 7:39661152-39661174 GGGAGATAACTGAATCATGGGGG - Intronic
1023386515 7:39663077-39663099 GGGAGACAACTGAATCATGGGGG - Intronic
1023652150 7:42382691-42382713 GGGAAAGAATTGAATCATGGGGG + Intergenic
1023787033 7:43717790-43717812 GGGAGATAACTGAATCATGGGGG + Intronic
1023804818 7:43865069-43865091 GGGAGATAACTGAATCATGGGGG + Intergenic
1024158429 7:46649472-46649494 GGGAGATAACTGAACCATGGGGG - Intergenic
1024169461 7:46769062-46769084 GGGACATAATTGAATCATGGGGG - Intergenic
1024757442 7:52552202-52552224 GGGAAATAACTGAATCATGGGGG + Intergenic
1024934944 7:54702402-54702424 GGCACAGGCCTGAAACGTGCAGG + Intergenic
1026527287 7:71165572-71165594 GGGAGATAACTGAATCATGGGGG - Intronic
1026597434 7:71745776-71745798 GGGAGATAACTGAATCATGGGGG + Intergenic
1026922499 7:74166513-74166535 GGGACCCAACTGAATCATGGAGG - Intergenic
1027581435 7:80001197-80001219 GGGAGATAACTGAATCATGGAGG - Intergenic
1027992894 7:85385635-85385657 GGGAGATAACTGAATCATGGGGG + Intergenic
1028648193 7:93121093-93121115 AGGACAGACCTGGCACGTGGGGG - Intergenic
1028668214 7:93371605-93371627 GGGAGATATCTGAATCATGGAGG - Intergenic
1029868381 7:103661203-103661225 GGGGCTGGCCTGAAACACGGGGG + Intronic
1031097709 7:117441279-117441301 GGGAGATAACTGAATCATGGGGG - Intergenic
1031131361 7:117836886-117836908 GGGAGATAACTGAATCATGGGGG - Intronic
1031442427 7:121811216-121811238 GGGAGATAACTGAATCATGGGGG - Intergenic
1031737769 7:125388348-125388370 GAGACAGAGGTGAAAGATGGAGG + Intergenic
1032029155 7:128467975-128467997 GGGACAGATTTGAAAAATGTGGG - Intergenic
1032865136 7:135917316-135917338 GGGAGATAACTGAATCATGGGGG + Intergenic
1032902373 7:136324165-136324187 GGGAGATAACTGAATCATGGGGG - Intergenic
1034134887 7:148757912-148757934 GGGAGACAACTGAATCATGGGGG - Intronic
1034677325 7:152901340-152901362 GGGAGATAACTGAATCATGGGGG - Intergenic
1035289900 7:157831249-157831271 GGGACAGGCCTGCACCATGGGGG - Intronic
1035321777 7:158034386-158034408 GGGAGGTACCTGAATCATGGGGG + Intronic
1035821781 8:2600640-2600662 GGGAGATAACTGAATCATGGGGG + Intergenic
1036623002 8:10439208-10439230 GGGAGATAACTGAATCATGGGGG - Intergenic
1036915455 8:12799743-12799765 GGGGAAGACCTGAAGCCTGGGGG - Intergenic
1037298647 8:17428097-17428119 GGGAGATAACTGAATCATGGGGG - Intergenic
1037394560 8:18428459-18428481 GGGAGATAACTGAATCATGGGGG + Intergenic
1037507606 8:19547422-19547444 GGGAGATAACTGAATCATGGGGG + Intronic
1037556054 8:20023658-20023680 GGGAAAGACGTGAGTCATGGGGG + Intergenic
1037628738 8:20632793-20632815 GGGAGATAACTGAATCATGGAGG - Intergenic
1037762987 8:21754418-21754440 AGCCCAGACCTGAAACTTGGGGG + Intronic
1039772209 8:40698820-40698842 GGGAGAGACTTCAAACATTGGGG + Intronic
1040288162 8:46110918-46110940 GGGACAGCCCTGAGAGATTGTGG + Intergenic
1040340450 8:46437847-46437869 GGGACAGACCTGAAATCTTCTGG + Intergenic
1040997557 8:53417472-53417494 AGGACAGAGCTGGGACATGGAGG + Intergenic
1041292277 8:56319273-56319295 GGCACAGCCATAAAACATGGAGG + Intronic
1041334732 8:56768960-56768982 GGGAGATAACTGAATCATGGGGG - Intergenic
1043267273 8:78282227-78282249 GGGAAAGACATGAAATATGATGG + Intergenic
1043783637 8:84368725-84368747 GGGAGATAACTGAATCATGGTGG - Intronic
1044029315 8:87214852-87214874 GGGAGATAACTGAATCATGGGGG - Intronic
1044462820 8:92465834-92465856 GAGAAAGACAGGAAACATGGCGG + Intergenic
1044858880 8:96502288-96502310 TGGAGATAACTGAAACATGGGGG - Intronic
1044956841 8:97490017-97490039 GGGAGATAACTGAATCATGGGGG + Intergenic
1045053741 8:98350785-98350807 GGGAGATAACTGAATCATGGGGG - Intergenic
1045593805 8:103629428-103629450 GGGGCAGACCAGAAGCATGTTGG + Intronic
1045597069 8:103669261-103669283 GGGAGACAACTGAATCATGGGGG - Intronic
1047487827 8:125348577-125348599 GGGAGATAACTGAATCATGGGGG + Intronic
1047513448 8:125532905-125532927 GGGAGATGCCTGAATCATGGGGG + Intergenic
1048266161 8:132989163-132989185 GGGAGATAACTGAATCATGGGGG - Intronic
1048576523 8:135694770-135694792 GGGAGATAGCTGAATCATGGGGG - Intergenic
1048783163 8:138023241-138023263 GGGAGATAACTGAATCATGGGGG - Intergenic
1050236784 9:3590049-3590071 GGGAGACAACTGAATCATGGGGG + Intergenic
1051212919 9:14764056-14764078 GGGAGATAACTGAATCATGGGGG + Intronic
1051424219 9:16917401-16917423 GGGAGGGAACTGAATCATGGGGG + Intergenic
1052025728 9:23571383-23571405 GGGAGATAACTGAATCATGGGGG + Intergenic
1052294684 9:26883284-26883306 GGGAGATAACTGAATCATGGGGG + Intronic
1052571313 9:30227741-30227763 GGGAGGTAACTGAAACATGGAGG + Intergenic
1052688552 9:31784224-31784246 GGGAGATAACTGAATCATGGCGG - Intergenic
1053489600 9:38488783-38488805 GGCACAGCCCTGAACCATGGAGG - Intergenic
1053565691 9:39248392-39248414 GGGAGATAACTGAATCATGGGGG - Intronic
1053831456 9:42086247-42086269 GGGAGATAACTGAATCATGGGGG - Intronic
1054131458 9:61370644-61370666 GGGAGATAACTGAATCATGGGGG + Intergenic
1054599091 9:67101191-67101213 GGGAGATAACTGAATCATGGGGG + Intergenic
1055083634 9:72291864-72291886 GGGAGATAACTGAATCATGGGGG - Intergenic
1055463844 9:76544639-76544661 GGGAGATAACTGAATCATGGGGG - Intergenic
1055815097 9:80195579-80195601 GGGAGAGAACTGAATCATGGGGG + Intergenic
1056005289 9:82263206-82263228 GGGAGATAACTGAATCATGGGGG - Intergenic
1056007445 9:82286971-82286993 GGGACGTAACTGAATCATGGGGG + Intergenic
1057007506 9:91573517-91573539 GGGAGATAACTGAACCATGGGGG + Intronic
1057669943 9:97078091-97078113 GGCACAGCCCTGAACCATGGAGG - Intergenic
1058892806 9:109375248-109375270 GGGAGACAACTGAATCATGGGGG + Intergenic
1059582393 9:115565956-115565978 GGGAGATAACTGAATCATGGGGG + Intergenic
1060474958 9:123979856-123979878 TGGAGATACCTGAATCATGGGGG - Intergenic
1062214427 9:135381365-135381387 GGGAGATAACTGAATCATGGGGG + Intergenic
1185604768 X:1361866-1361888 AGGACATAACTGAATCATGGGGG - Intronic
1185893501 X:3839704-3839726 GGGAAGTACCTGAATCATGGTGG + Intronic
1185898618 X:3878128-3878150 GGGAAGTACCTGAATCATGGTGG + Intergenic
1185903733 X:3916557-3916579 GGGAAGTACCTGAATCATGGTGG + Intergenic
1186117610 X:6321413-6321435 GGGAAATAACTGAATCATGGGGG - Intergenic
1186258064 X:7744279-7744301 GGGAGATACTTGAATCATGGGGG + Intergenic
1186277743 X:7958131-7958153 GGGAGATAACTGAATCATGGGGG - Intergenic
1187429503 X:19209322-19209344 GGGAGATAACTGAATCATGGAGG + Intergenic
1187580653 X:20603817-20603839 GGGAGAGAATTGAATCATGGGGG + Intergenic
1188187459 X:27131896-27131918 GGGAGAGAATTGAATCATGGGGG - Intergenic
1188520517 X:31033194-31033216 GGGAGATAATTGAAACATGGAGG - Intergenic
1188704016 X:33303599-33303621 GGGAGATAACTGAATCATGGGGG + Intronic
1189228553 X:39433958-39433980 GGGACATAATTGAATCATGGGGG - Intergenic
1189229654 X:39442424-39442446 AGGGCAACCCTGAAACATGGGGG - Intergenic
1190239906 X:48649812-48649834 GGGAGATAACTGAATCATGGGGG - Intergenic
1190466979 X:50734774-50734796 GGGAGATAACTGAATCATGGGGG + Intronic
1190845314 X:54185214-54185236 GGGACAGAAGTGAAAGATGCTGG + Intergenic
1191009254 X:55743886-55743908 GGGACAGCCCTGAAAGAAAGTGG - Intronic
1191853332 X:65602406-65602428 GGGAAAGACTGGAAACAGGGAGG - Intronic
1192344510 X:70290062-70290084 GGGACGGATTTGAAACTTGGCGG + Intronic
1192934793 X:75848591-75848613 GGGAAATAACTGAATCATGGTGG - Intergenic
1193388057 X:80894073-80894095 GGGAGATAACTGAATCATGGGGG + Intergenic
1194259904 X:91681768-91681790 GGGAGATAACTGAATCATGGGGG - Intergenic
1194527143 X:94990642-94990664 GGGAGATAACTGAATCATGGGGG - Intergenic
1194755224 X:97731510-97731532 GGGAGATAACTGAATCATGGGGG - Intergenic
1195039237 X:100999096-100999118 GGGACATTCATGATACATGGAGG - Intergenic
1195554996 X:106211579-106211601 GGGAGATAACTGAATCATGGGGG - Intergenic
1195937731 X:110141594-110141616 GGGAGATAACTGAATCATGGGGG - Intronic
1199569518 X:149253485-149253507 GGGAGATAACTGAATCATGGGGG - Intergenic
1200276796 X:154741047-154741069 GGGAGATAACTGAATCATGGAGG + Intronic
1200341980 X:155407681-155407703 GGGAGATAACTGAATCATGGGGG + Intergenic
1200575510 Y:4884330-4884352 GGGAGATAACTGAATCATGGGGG + Intergenic
1200575766 Y:4886234-4886256 GAGAGAGAACTGAATCATGGGGG + Intergenic
1200578602 Y:4920958-4920980 GGGAGATAACTGAATCATGGGGG - Intergenic
1200784147 Y:7244381-7244403 GGGAGATAACTGAATCATGGAGG + Intergenic
1201448550 Y:14084301-14084323 GGGAGATAACTGAATCATGGGGG + Intergenic
1201479732 Y:14426889-14426911 GGGACATAACTGAATCATGGGGG + Intergenic
1201495488 Y:14588462-14588484 GGGAGATAATTGAAACATGGGGG - Intronic
1201738491 Y:17297880-17297902 AGGCCATACCTGAAAAATGGGGG + Intergenic