ID: 982761543

View in Genome Browser
Species Human (GRCh38)
Location 4:159290146-159290168
Sequence CAGTGGCACCACAGTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982761543 Original CRISPR CAGTGGCACCACAGTGAAGT GGG Intronic
901195002 1:7435557-7435579 CACTGCCACCACAGTGAACCAGG - Intronic
903141465 1:21341739-21341761 GAGAGGCACCAGAGTGACGTGGG + Intronic
903789105 1:25880737-25880759 CAGTGGGAGCACAATGAAGCAGG + Intergenic
906732282 1:48093318-48093340 CAGCGCCAGCCCAGTGAAGTAGG - Intergenic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
912561247 1:110553158-110553180 CAGGGGCTCCTCAGTGAAGGTGG + Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
914851299 1:151316250-151316272 CAGAGGCACCCCACTGGAGTTGG - Exonic
915802429 1:158808591-158808613 TAGTGCCACCACAGTTACGTGGG + Intergenic
916795414 1:168162545-168162567 CTGTGGCATCACAGTGACATAGG + Intergenic
917716398 1:177742065-177742087 CAGTGTCACCACAGTGGTGATGG + Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
923503890 1:234589319-234589341 CAGTGGCAGCACAGTAAAGAGGG + Intergenic
924034385 1:239921469-239921491 CAGTGGCATCACACTCATGTCGG + Intergenic
924121923 1:240808984-240809006 CAGTGGAAACCCAGTGAAATAGG - Intronic
1062854088 10:770587-770609 CAGAGGCACCTCTGGGAAGTGGG + Intergenic
1065823696 10:29550692-29550714 CCGTGGCACTTCAGTGAAGGAGG + Exonic
1067185623 10:44024766-44024788 GATTCGCATCACAGTGAAGTCGG - Intergenic
1067742656 10:48907640-48907662 CAGAGGCACCACAGTTAGCTGGG + Intronic
1068066415 10:52138057-52138079 CAGAGGCAACACAGTGAATCAGG - Intronic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1069889979 10:71646625-71646647 CAGTGGCCCTGCAGTGAAGCGGG - Intronic
1070355059 10:75631689-75631711 CATCAGCGCCACAGTGAAGTGGG + Intronic
1070584860 10:77756490-77756512 CAGTAGCACCACACTGTAGGAGG + Intergenic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075083448 10:119398832-119398854 CAGTGGCAGGACAGTGAAGCCGG - Intronic
1076645544 10:131951938-131951960 GAGTGGCAACACAGTGCAGGGGG + Intronic
1077037213 11:501182-501204 CAGTGGCGTCACAGTGGAGAGGG + Intronic
1077445104 11:2587161-2587183 CAGTGGCCACACAGTGAGGAAGG - Intronic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1080093931 11:28382217-28382239 CAGTGGCACCACACTGTAAGTGG - Intergenic
1082902190 11:58267136-58267158 CAGCAGCACCACAGTGAGGTGGG + Exonic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1084344615 11:68537917-68537939 GAGTGGGACTAAAGTGAAGTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084597390 11:70125038-70125060 CCAAGGCACCACAGAGAAGTGGG + Intronic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089081230 11:115777702-115777724 CAGCGGCATCACAGTGTAATGGG + Intergenic
1090040930 11:123290775-123290797 CAGTGGGAGAACACTGAAGTGGG - Intergenic
1093316939 12:17664013-17664035 CAGTAGCACCTCACTCAAGTTGG - Intergenic
1094543633 12:31383771-31383793 CAGTGGCATTACACTGATGTTGG - Exonic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1098190830 12:67946642-67946664 TTGTGTCACCACAGTGAACTGGG + Intergenic
1099600082 12:84723976-84723998 CAGTGGCACCAAACTATAGTGGG + Intergenic
1100672193 12:96828127-96828149 CACTGGCAACATTGTGAAGTAGG + Intronic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1104981483 12:132574853-132574875 CAGAGGCACCCCAGTGACGTGGG - Intronic
1105306231 13:19170879-19170901 CAGTGGCCCAATAATGAAGTTGG - Intergenic
1106545290 13:30725830-30725852 CACTGGCCTCACAGTGAAGCAGG + Intronic
1106548337 13:30749910-30749932 CAGTGGTACCACTGAGAACTTGG - Intronic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1112042673 13:95562920-95562942 CAATGGCACTACACTGAATTAGG - Intronic
1114140675 14:19906403-19906425 CAGGGTCACCACAGTCACGTGGG - Intergenic
1115857051 14:37641560-37641582 TAGTCTCACCACAGTGAAGAGGG + Intronic
1121021263 14:90581513-90581535 CAGTGGCAACACAGGGGAGCAGG + Intronic
1126886383 15:53155573-53155595 TAGAAGCACCACAGTGAAGACGG - Intergenic
1127808964 15:62546711-62546733 CAGTGGCCACACAGCGAAGGCGG + Intronic
1134717703 16:16365120-16365142 CAGGGGCACCACCGTGCAGCTGG - Intergenic
1134957049 16:18387039-18387061 CAGGGGCACCACCGTGCAGCTGG + Intergenic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1138888310 16:61108465-61108487 CAGTGGAACAGCACTGAAGTTGG + Intergenic
1139047174 16:63076053-63076075 CAGCAGCACCACAGTGTAGGAGG - Intergenic
1142744249 17:1947830-1947852 CCGTGGCAGCACATTGCAGTGGG + Intronic
1142942877 17:3397661-3397683 CAGTGACACCACAGACAGGTGGG + Exonic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143102452 17:4511943-4511965 AAGTCACACCACAGGGAAGTAGG - Intronic
1143620016 17:8075403-8075425 CAGTGGCATCTCAGAGAGGTTGG - Intronic
1144086555 17:11814306-11814328 CAGGGGCACCAGAGTAAAATGGG - Intronic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1158682602 18:59582079-59582101 CAGTGGCAGACCAGTCAAGTGGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165383574 19:35497367-35497389 CTGAAGCACCACAGTGCAGTGGG + Exonic
1166576387 19:43842714-43842736 AAGTGTCACCACAGTGAAAAAGG - Intronic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927807642 2:26162045-26162067 AAGTGCCGCCATAGTGAAGTGGG - Intergenic
932285419 2:70527808-70527830 CAGTTACAGCACTGTGAAGTTGG + Intronic
934564485 2:95330714-95330736 CAGTGCCAGCCCAGTGAACTGGG - Intronic
937482960 2:122281864-122281886 CAGTGCCAGCACAGTGTGGTGGG + Intergenic
938248404 2:129796275-129796297 CAGTCGCACCACAGTAAAAGCGG + Intergenic
947519811 2:230836857-230836879 CAGTGGCAGCAAAGTGCAGGGGG - Intergenic
948076994 2:235172594-235172616 CAGAAGCACCACATTGCAGTAGG + Intergenic
948465325 2:238149288-238149310 CAGAGGGCCCACAGTGAAGGGGG + Intronic
948465338 2:238149332-238149354 CAGAGGGCCCACAGTGAAGAGGG + Intronic
949069167 2:242013170-242013192 CAGAGGCTCCACAGAGAAGGGGG + Intergenic
1169619034 20:7483884-7483906 CATTGGCACCTCAGTGAGGAAGG - Intergenic
1179117436 21:38507047-38507069 CAGTTGCACCCCAGCGAAGCTGG - Intronic
1179798806 21:43800904-43800926 CAGTGGCACCACCTTGGAGGTGG + Intronic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1181672787 22:24433526-24433548 CAGTGACACCACAAAGTAGTTGG - Exonic
1185168205 22:49275228-49275250 CACTGGGACCACTCTGAAGTTGG + Intergenic
949138572 3:602606-602628 CAGTGTCTACACAGTCAAGTAGG + Intergenic
950301774 3:11885781-11885803 CAGTAGTTCCACAGTGAAGAAGG - Intergenic
951359898 3:21712965-21712987 AAGTGGCACCACTGGCAAGTTGG - Intronic
953135738 3:40180411-40180433 CAGTTGCTCCACAGTCTAGTGGG + Intronic
956224917 3:66946743-66946765 CCTTGGCAACACAGTGAATTCGG + Intergenic
956250643 3:67230715-67230737 CAGGGACACCACCGTGGAGTGGG - Intergenic
957150852 3:76484448-76484470 CAGTGAGTCCACAGTCAAGTGGG + Intronic
958747802 3:98158425-98158447 CACTGAAATCACAGTGAAGTTGG + Intergenic
958753099 3:98216193-98216215 CACTGAAATCACAGTGAAGTTGG + Intergenic
960464960 3:117986314-117986336 CAGAGGCAGCACAGTAAAGAAGG + Intergenic
960520534 3:118649394-118649416 CATTTGTACCACAGTGAGGTAGG - Intergenic
961371509 3:126434535-126434557 GAGGGGCATCACAGTCAAGTGGG + Intronic
970840461 4:20462590-20462612 CAGTGGGTCACCAGTGAAGTAGG - Intronic
974025269 4:56728180-56728202 AAATGGCACCCCAGTGAAGGAGG + Intergenic
977754736 4:100654688-100654710 CAGTTACACCACACTAAAGTTGG - Intronic
979408226 4:120341070-120341092 CAGTGACTCCACAGTGAAGCAGG + Intergenic
980791976 4:137632161-137632183 CAGTGGCAGCACAGAGCAGGGGG - Intergenic
981935126 4:150230985-150231007 CAGTAGCACCACACTGATTTGGG - Intronic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
983102687 4:163644816-163644838 CAGTGGGACCAAAGTTAAGCAGG - Intronic
984874502 4:184355194-184355216 CAGGGGCAACACAGCGAAGAAGG + Intergenic
985652079 5:1111962-1111984 CACGGGCACCACGGTGAAGTTGG + Exonic
988499057 5:31768869-31768891 CAGTATTACCACAGCGAAGTTGG - Intronic
990205011 5:53419520-53419542 CAGTAGGACCACAGTAATGTGGG - Intergenic
992758733 5:79933160-79933182 CAGTGGCAAAACAGTGATGGTGG - Intergenic
993372099 5:87105520-87105542 AAGTGGAACCACAGTGAAGGTGG + Intergenic
997345592 5:133189723-133189745 CAGTGGCCTCACAGGGAAATGGG - Intergenic
999806041 5:155082241-155082263 CAGTGGCATCACAGTCTAATGGG + Intergenic
1001415160 5:171540511-171540533 CAGAGGCAGCACAGGGGAGTCGG - Intergenic
1003533489 6:6956480-6956502 GAGTGGAACCATAGTGGAGTTGG - Intergenic
1003695150 6:8398416-8398438 AAGTTGAACCACAGTGAATTGGG + Intergenic
1004013395 6:11710740-11710762 AAGTGGCACTCCAGTGAGGTCGG + Intergenic
1004789945 6:19014368-19014390 CAGTGCTACTTCAGTGAAGTTGG - Intergenic
1006942418 6:37761847-37761869 TAGTGGCACCACGGTGCGGTGGG + Intergenic
1008405988 6:51119177-51119199 CAATGGAACCAAAGGGAAGTAGG - Intergenic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1014209908 6:118697490-118697512 CAGTCCCACCAAAGTGAAGGTGG - Intronic
1016471887 6:144383330-144383352 CAGTGGCACCAGATTGAGTTAGG + Intronic
1019500191 7:1360784-1360806 CAGCGGCACCGCTGTGAAGTGGG + Intergenic
1021275272 7:18642360-18642382 CAGGGGAACCACAGAAAAGTAGG - Intronic
1021742661 7:23703439-23703461 CTGTGCCACTACAGTGAAATGGG + Intergenic
1024608293 7:51040733-51040755 CAGTGGCACCCCAGAGATGAGGG + Intronic
1026618766 7:71932061-71932083 CAGTGGCACAACAGAAAAGCTGG - Intronic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1028879335 7:95861993-95862015 CACTGGCAAAAGAGTGAAGTTGG + Intronic
1030791295 7:113732312-113732334 CTGTGGTATCAGAGTGAAGTGGG - Intergenic
1034927473 7:155133682-155133704 AAGTGGCTCCACACTGAACTTGG - Intergenic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1036625600 8:10469185-10469207 CAGAGGAATAACAGTGAAGTCGG + Intergenic
1038427400 8:27472877-27472899 CACTGTCACCACAGTCAAGAGGG - Intronic
1039537926 8:38335830-38335852 TAGCAGCAACACAGTGAAGTAGG - Intronic
1039805124 8:40991188-40991210 CAGTGGCACAAGTTTGAAGTGGG + Intergenic
1042624774 8:70745704-70745726 CAATGGAACCACAGAGAAATTGG + Intronic
1043891146 8:85654193-85654215 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043892222 8:85661030-85661052 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043893341 8:85716310-85716332 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896024 8:85737759-85737781 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896655 8:85744049-85744071 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043898978 8:85762416-85762438 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043900589 8:85774610-85774632 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043902553 8:85789885-85789907 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043904163 8:85802078-85802100 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043905775 8:85814272-85814294 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043907383 8:85826459-85826481 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1044508411 8:93048100-93048122 CAGGGGCACCATAATGGAGTTGG - Intergenic
1046266848 8:111842026-111842048 ACGTGGCATTACAGTGAAGTTGG + Intergenic
1046744534 8:117862767-117862789 CAGTGGCATCTCAGTAAAGATGG + Intronic
1047648183 8:126890917-126890939 AAGTGGCTCCACACTGAAGCAGG - Intergenic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1049058876 8:140260283-140260305 CCGTGGCTCGAGAGTGAAGTGGG + Intronic
1049152043 8:141041275-141041297 CACTGGGACAGCAGTGAAGTAGG + Intergenic
1055804466 9:80077023-80077045 CATTGGTGCCACAGTGATGTTGG + Intergenic
1057527664 9:95816886-95816908 CAGTGGCTCCACAGCCAAGCAGG - Intergenic
1061994998 9:134178714-134178736 CAGTGGCACCAAACTGAAAGGGG - Intergenic
1062625207 9:137439342-137439364 CAGTGGTACCCGTGTGAAGTGGG - Intronic
1203618757 Un_KI270749v1:97743-97765 CAGTGTCTACACAGTCAAGTAGG - Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186381888 X:9069593-9069615 CTGAGGCCCCACAGAGAAGTTGG - Intronic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1195130397 X:101845320-101845342 CAGTGGCATGGCAGTGATGTAGG - Intronic
1195175867 X:102314922-102314944 CAGTGGCATGGCAGTGATGTAGG + Intronic
1195182997 X:102372171-102372193 CAGTGGCATGGCAGTGATGTAGG - Intronic
1195670558 X:107466332-107466354 CAGTGGCAAAACTGTGAGGTTGG - Intergenic
1201277091 Y:12309414-12309436 TAGTGGCACATTAGTGAAGTGGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic