ID: 982777919

View in Genome Browser
Species Human (GRCh38)
Location 4:159461083-159461105
Sequence TATCCCTGCCCCTTTGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982777919_982777925 21 Left 982777919 4:159461083-159461105 CCCATAACAAAGGGGCAGGGATA No data
Right 982777925 4:159461127-159461149 GATGCTCCTGAGCTTAATCTTGG No data
982777919_982777922 -9 Left 982777919 4:159461083-159461105 CCCATAACAAAGGGGCAGGGATA No data
Right 982777922 4:159461097-159461119 GCAGGGATATGACCCAAGCTGGG No data
982777919_982777921 -10 Left 982777919 4:159461083-159461105 CCCATAACAAAGGGGCAGGGATA No data
Right 982777921 4:159461096-159461118 GGCAGGGATATGACCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982777919 Original CRISPR TATCCCTGCCCCTTTGTTAT GGG (reversed) Intergenic
No off target data available for this crispr